Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2347 bp · TkA07G371360|TK1151|cDNA
TTATAGATCAAACTCGCTCATATCATCAACACACCTACAAGGGACACTCTGGCCTCTGCAACAAACACTCCCGCAGATTTTAGAACAATGGGAGGAACTGCAAGAATCCTAACCCTCTCATTATCTTCAACCACCACCACCCGCCTCTCTTTCTCCCTCCTTTCCTTCCCCAAATTCCATCCTCCTCGTAGGGTTTATCAAGGGTTTAGGTCCCTCTCCATCACCGCCGCCGCCGCCACCACCACCCCCTTCACAGACGA...
1995 bp · TkA07G371360|TK1151|CDS
ATGGGAGGAACTGCAAGAATCCTAACCCTCTCATTATCTTCAACCACCACCACCCGCCTCTCTTTCTCCCTCCTTTCCTTCCCCAAATTCCATCCTCCTCGTAGGGTTTATCAAGGGTTTAGGTCCCTCTCCATCACCGCCGCCGCCGCCACCACCACCCCCTTCACAGACGAACCATCATTAGAATCATCCAAGCACTCTATCCTCCTTGAACGTCTCAGAATCAGACACCTCAAAGATTCAGTAGGTAGTACCTACAA...
Protein
Download Protein FASTA664 aa · TkA07G371360|TK1151|PROTEIN
MGGTARILTLSLSSTTTTRLSFSLLSFPKFHPPRRVYQGFRSLSITAAAATTTPFTDEPSLESSKHSILLERLRIRHLKDSVGSTYKTNNKKAQSIPFQESEIEDGSSKHLKSKKEEEYSFTELGLSEEVLAALTEMGITAPTEIQSLGIPAVIDEKSVVLGSHTGSGKTLAYLLPLVQLLRQDEALNGMAMKPRRPRAVVLCPTRELCEQVFGVAKAISHHARFRATMVSGGGRLRPQEDALNSPIDMVVGTPGRVLQH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G371360 |
|---|---|
| TK1151 ID | TkA07G371360 |
| OH-1004 ID | LXL04_030027 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.200 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G371360 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:93153962-93156956 (+) | ||||||||||||
| Description | Similar to RH39: DEAD-box ATP-dependent RNA helicase 39 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006401 RNA catabolic process Biological Process GO:0006968 cellular defense response Biological Process GO:0050832 defense response to fungus Biological Process GO:0071369 cellular response to ethylene stimulus Biological Process GO:0071395 cellular response to jasmonic acid stimulus Biological Process GO:0071446 cellular response to salicylic acid stimulus Biological Process GO:0110102 ribulose bisphosphate carboxylase complex assembly Biological Process GO:1901259 chloroplast rRNA processing Biological Process GO:1902775 mitochondrial large ribosomal subunit assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005829 cytosol Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT3G06980 ath:AT4G09730 dosa:Os01g0184500 dosa:Os03g0108600 sfr:Sfri_0461 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF30554Bfr157-154 aaPF25996HTH_CLF_N121-146 aaPF00270DEAD143-325 aaPF04851ResIII155-279 aaPF00271Helicase_C192-233 aaPF04364DNA_pol3_chi350-397 aaPF16203ERCC3_RAD25_C361-451 aaPF00271Helicase_C362-473 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G371360 | PF30554 | Bfr1 | 57 | 154 | 0.025 | 14.5 |
| TkA07G371360 | PF25996 | HTH_CLF_N | 121 | 146 | 0.19 | 12.1 |
| TkA07G371360 | PF00270 | DEAD | 143 | 325 | 1.1e-38 | 133.3 |
| TkA07G371360 | PF04851 | ResIII | 155 | 279 | 0.00011 | 22.9 |
| TkA07G371360 | PF00271 | Helicase_C | 192 | 233 | 1.1e-28 | 100.4 |
| TkA07G371360 | PF04364 | DNA_pol3_chi | 350 | 397 | 0.084 | 13.8 |
| TkA07G371360 | PF16203 | ERCC3_RAD25_C | 361 | 451 | 0.21 | 11.6 |
| TkA07G371360 | PF00271 | Helicase_C | 362 | 473 | 1.1e-28 | 100.4 |
| TkA07G371360 | PF22590 | Cas3-like_C_2 | 377 | 471 | 0.0003 | 21.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.