TkA07G367300 | RubberDandelionOmics

Gene overview

TkA07G367300

Reference: TK1151 Chr: Chr07 Coordinates: 92024486-92026954 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

867 bp · TkA07G367300|TK1151|cDNA

ATGCCAAATGCTTCAGGGAATCCATCAGTAGCACGAAAGGCATCTGGAGATGAGAGTTCAAAGACTCGGCCGATTAAGTTCTATCTACATGCTAGTGGAAATGTTGCTGCAAAATTTGCATATGACCAGGTACTTGTGGGAGCATTGCGTAAGATCCCAAGAGCAACTTGGCATGCAAAAGAAAGATTGTGGATGTTCCCCTTGGTATCCTTACCAGCAGCAGAAAAAGTTCTTGGCGAATTATCCGGTTCTAACATGGA...

CDS

Download CDS FASTA

867 bp · TkA07G367300|TK1151|CDS

ATGCCAAATGCTTCAGGGAATCCATCAGTAGCACGAAAGGCATCTGGAGATGAGAGTTCAAAGACTCGGCCGATTAAGTTCTATCTACATGCTAGTGGAAATGTTGCTGCAAAATTTGCATATGACCAGGTACTTGTGGGAGCATTGCGTAAGATCCCAAGAGCAACTTGGCATGCAAAAGAAAGATTGTGGATGTTCCCCTTGGTATCCTTACCAGCAGCAGAAAAAGTTCTTGGCGAATTATCCGGTTCTAACATGGA...

Protein

Download Protein FASTA

288 aa · TkA07G367300|TK1151|PROTEIN

MPNASGNPSVARKASGDESSKTRPIKFYLHASGNVAAKFAYDQVLVGALRKIPRATWHAKERLWMFPLVSLPAAEKVLGELSGSNMEVESLDPLLQRAISAASTVPDLQDRYESMPDCIKSKLLPFQQEGVRFILQHGGLVLLADEMGFGKTLQAIAVVSCVRDSWPVLVLIFITPSMGFCNFSLLLTLVVIADESHFLKNAQAKRTTASLPILQKARYTMLLSGTPALSRPIELFKQVFLDLADKDMKQINALFRELEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G367300`
TK1151 ID	TkA07G367300
OH-1004 ID	LXL04_029990
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G367300`
Location	Chr07:92024486-92026954 (+)
Description	Similar to SMARCAL1: SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029990` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000278 mitotic cell cycle Biological Process GO:0006281 DNA repair Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006974 DNA damage response Biological Process GO:0010172 embryonic body morphogenesis Biological Process GO:0031297 replication fork processing Biological Process GO:0048589 developmental growth Biological Process GO:0090656 t-circle formation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005662 DNA replication factor A complex Cellular Component
KEGG gene cross-reference	bta:338072 dre:560412 hsa:50485 mmu:54380 xtr:780385 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.435

Rank 1 · TkA07G367300 · TK1151

Nucleus0.384

Rank 2 · TkA07G367300 · TK1151

Mitochondrion0.104

Rank 3 · TkA07G367300 · TK1151

Endoplasmic reticulum0.101

Rank 4 · TkA07G367300 · TK1151

Extracellular0.066

Rank 5 · TkA07G367300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00176SNF2-rel_dom127-164 aa

PF00176SNF2-rel_dom191-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G367300	`PF00176`	SNF2-rel_dom	127	164	1.2e-10	41.7
TkA07G367300	`PF00176`	SNF2-rel_dom	191	236	1.2e-10	41.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card