TkA07G353630 | RubberDandelionOmics

Gene overview

TkA07G353630

Reference: TK1151 Chr: Chr07 Coordinates: 88422548-88425609 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2895 bp · TkA07G353630|TK1151|cDNA

TTAAAACACTAGAAAATTAATATAAATCCTATAAAAACTTAGATCGCACCCAGTTAAATTTTTTTCTGGATCCGCCTTAACCTTATTTGCAAAGCCCGTGATGAATATCATATTCATGGCCCAATTACTGCTTGCATTTCTCATCTTTCAGTTTGTCCAAACCAATGTTAATGGAGAATCCATTAACTTGTCATCTCCACTTGTTGCTGGTGCACAATCCAAGAATGCATGGTACTCCGACTCTAAGATGTTTGCATTTG...

CDS

Download CDS FASTA

2367 bp · TkA07G353630|TK1151|CDS

ATGAATATCATATTCATGGCCCAATTACTGCTTGCATTTCTCATCTTTCAGTTTGTCCAAACCAATGTTAATGGAGAATCCATTAACTTGTCATCTCCACTTGTTGCTGGTGCACAATCCAAGAATGCATGGTACTCCGACTCTAAGATGTTTGCATTTGGGTTTTACCAATTACAAGGCACCACCGGATACGTGGTCGCAATCTGGTTAGAAAGCTTCGGAGAAAACACGGTTGTGTGGACTGCTTATCGAGACGATCC...

Protein

Download Protein FASTA

788 aa · TkA07G353630|TK1151|PROTEIN

MNIIFMAQLLLAFLIFQFVQTNVNGESINLSSPLVAGAQSKNAWYSDSKMFAFGFYQLQGTTGYVVAIWLESFGENTVVWTAYRDDPPVSKNATLTQTLERELVLSCEDSGVNKKIATNVSSAVMNNTGNFVLYDDKMGVVWQSFDHPTDSLLKGQSLFRGNELVSSLSKTNYSSGRFCIKMQMDGNIVMYPVNTEGNGEAAYWASQTNEDKISNNSLYLSDTGLLLINGSNISSTVKTLYPKPKDTAFYRATLGDDGIF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G353630`
TK1151 ID	TkA07G353630
OH-1004 ID	LXL04_029853
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.000
Protein coverage (%)	TK1151 100.000 / OH-1004 95.838 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G353630

Location Chr07:88422548-88425609 (-)

Description Similar to LECRK3: G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q25AG3`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`Os04g0202500`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`UniProt: A2XQD3`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`Os04g0201900`	Involved in innate immunity.	No verified direct reference in this release
`Os04g0202300`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029853 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0051707 response to other organism Biological Process

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030246 carbohydrate binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0201900

dosa:Os04g0202350

dosa:Os04g0202500

osa:9266608

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.848

Rank 1 · TkA07G353630 · TK1151

Endoplasmic reticulum0.084

Rank 2 · TkA07G353630 · TK1151

Cytoplasm0.072

Rank 3 · TkA07G353630 · TK1151

Nucleus0.037

Rank 4 · TkA07G353630 · TK1151

Lysosome / Vacuole0.031

Rank 5 · TkA07G353630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453B_lectin77-159 aa

PF00954S_locus_glycop167-210 aa

PF29681LIP1_C170-211 aa

PF01453B_lectin179-257 aa

PF00954S_locus_glycop235-309 aa

PF08277PAN_3361-411 aa

PF08276PAN_2361-381 aa

PF07714PK_Tyr_Ser-Thr506-711 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G353630	`PF01453`	B_lectin	77	159	2.4e-17	64.0
TkA07G353630	`PF00954`	S_locus_glycop	167	210	3.7e-06	28.1
TkA07G353630	`PF29681`	LIP1_C	170	211	0.1	13.7
TkA07G353630	`PF01453`	B_lectin	179	257	2.4e-17	64.0
TkA07G353630	`PF00954`	S_locus_glycop	235	309	3.7e-06	28.1
TkA07G353630	`PF08277`	PAN_3	361	411	0.018	15.6
TkA07G353630	`PF08276`	PAN_2	361	381	0.045	14.6
TkA07G353630	`PF07714`	PK_Tyr_Ser-Thr	506	711	6.8e-41	141.0
TkA07G353630	`PF00069`	Pkinase	507	769	8.7e-47	160.4
TkA07G353630	`PF03109`	ABC1	509	539	0.0076	16.2
TkA07G353630	`PF03109`	ABC1	574	660	0.0076	16.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q25AG3`	Oryza sativa subsp. indica	sp\|Q25AG3\|LERK3_ORYSI G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3	38.700%	Swiss-Prot	Medium
`Q0JEU6`	Oryza sativa subsp. japonica	sp\|Q0JEU6\|LERK3_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3	39.000%	Swiss-Prot	Medium
`A2XQD3`	Oryza sativa subsp. indica	sp\|A2XQD3\|LERK2_ORYSI G-type lectin S-receptor-like serine/threonine-protein kinase LECRK2	38.300%	Swiss-Prot	Medium
`Q7FAZ3`	Oryza sativa subsp. japonica	sp\|Q7FAZ3\|LERK1_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK1	38.000%	Swiss-Prot	Medium
`Q7FAZ2`	Oryza sativa subsp. japonica	sp\|Q7FAZ2\|LERK2_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK2	38.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card