RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G333080
Reference: TK1151 Chr: Chr07 Coordinates: 83270080-83274333 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2205 bp · TkA07G333080|TK1151|cDNA

AAGGAATAAAGTATGATAATTTATGAAAAGTTAAATTTATATGACATTATATAGTATGAGTTAAGCATTTAAGCGAAAGTGATGAGAAACATCTTCATGATGTACTTCAATTTTTGTTCGTTGTTGTACTCCGTATATCATGCATGTGGCATGCCTATATGTATAACTACATTCTTGTCGTTTGGTTCTCTTGCATTACCGGCCATTCCCATTTCCATTTAACTTTCTTACGTCTCTTGTTTCCTTTAAACAGCCAAGAA...

CDS

Download CDS FASTA

906 bp · TkA07G333080|TK1151|CDS

ATGGTGTTTGGTCTCACTGCCAAAAAGTTAATAAGTTATGACCGAGAGCAGTCATCCGAGAATCTACGAGACAACTTTGAAGCTTTTATCAAGGGTTTAATTTCAGTCCCTTTGGAGATTCCTGGGACTTCTTACTACAAGTGTATGCAGGGAAGAAAGAAGGCGATGAGATTTCTCAAGAACAAGTTAGAGGAAAGAAGGGAAAAGCCTAATGAGGTCAACATCGATTTCTTTGATTATGTTCTTGAAGAACTCGGGGA...

Protein

Download Protein FASTA

301 aa · TkA07G333080|TK1151|PROTEIN

MVFGLTAKKLISYDREQSSENLRDNFEAFIKGLISVPLEIPGTSYYKCMQGRKKAMRFLKNKLEERREKPNEVNIDFFDYVLEELGEDDPILTEEIALDLMFMLLFASFETTSTAMLVSMKLLTDNPQALKEVREEHEQILKKRENPESGLTWEEYKSMTFTFQVINESVRLANIVPGIFRKARTDIKFKDYTIPSGWVVMVCPPAVHLDPIKYKDPLEFNPWRWEEMDFKGTSKSFMAFGGGQRFCVGADFARLQMAVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G333080
TK1151 IDTkA07G333080
OH-1004 IDLXL04_029651
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.700
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G333080
LocationChr07:83270080-83274333 (-)
DescriptionSimilar to CYP87A3: Cytochrome P450 87A3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g48000 Hydroxylates thalianol into thalian-diol. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0570000 Cytochrome P450 87A3. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_029651 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006694 steroid biosynthetic process Biological Process
GO:0008203 cholesterol metabolic process Biological Process
GO:0010268 brassinosteroid homeostasis Biological Process
GO:0016125 sterol metabolic process Biological Process
GO:0016132 brassinosteroid biosynthetic process Biological Process
GO:0016135 saponin biosynthetic process Biological Process
GO:0048364 root development Biological Process
GO:0080003 thalianol metabolic process Biological Process
GO:0005783 endoplasmic reticulum Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0016020 membrane Cellular Component
GO:0030659 cytoplasmic vesicle membrane Cellular Component
KEGG gene cross-reference
ag:AEM42986
ag:AHF22090
ath:AT5G48000
dosa:Os04g0570000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.913
Rank 1 · TkA07G333080 · TK1151
Cytoplasm0.053
Rank 2 · TkA07G333080 · TK1151
Nucleus0.032
Rank 3 · TkA07G333080 · TK1151
Mitochondrion0.029
Rank 4 · TkA07G333080 · TK1151
Cell membrane0.028
Rank 5 · TkA07G333080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45041-281 aa
PF16444DUF5041110-253 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G333080PF00067p450412812.6e-55188.7
TkA07G333080PF16444DUF50411102530.1212.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8L7D5Arabidopsis thalianasp|Q8L7D5|THAH_ARATH Cytochrome P450 708A242.400%Swiss-ProtMedium
Q7XU38Oryza sativa subsp. japonicasp|Q7XU38|C87A3_ORYSJ Cytochrome P450 87A361.700%Swiss-ProtHigh

JBrowse

View in Genome Browser