TkA07G324870 | RubberDandelionOmics

Gene overview

TkA07G324870

Reference: TK1151 Chr: Chr07 Coordinates: 81347196-81348177 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

405 bp · TkA07G324870|TK1151|cDNA

ATGGCCGACGAAATAGGCGCAGGTGGAGACGATTGTTTTGTACACCCAGAACTTTTGCAAAGAAGAAAGGAATCGGTGGTGGTTGAATCGAAGTCGGATAGTGGCCTCACTTGCAGTCTTCCTGTTTCGAGAAAACGAGCTAGAGATTACGGAGAAAGTGAGACTCGACATCGAAGAGCGACGCAAGAGAAATTCACGGCGATTAATCGCGGCGGTGGAGGAAGGATTATCGAAGAGACTACGAGCAAAAGAGGAATCGG...

CDS

Download CDS FASTA

405 bp · TkA07G324870|TK1151|CDS

ATGGCCGACGAAATAGGCGCAGGTGGAGACGATTGTTTTGTACACCCAGAACTTTTGCAAAGAAGAAAGGAATCGGTGGTGGTTGAATCGAAGTCGGATAGTGGCCTCACTTGCAGTCTTCCTGTTTCGAGAAAACGAGCTAGAGATTACGGAGAAAGTGAGACTCGACATCGAAGAGCGACGCAAGAGAAATTCACGGCGATTAATCGCGGCGGTGGAGGAAGGATTATCGAAGAGACTACGAGCAAAAGAGGAATCGG...

Protein

Download Protein FASTA

134 aa · TkA07G324870|TK1151|PROTEIN

MADEIGAGGDDCFVHPELLQRRKESVVVESKSDSGLTCSLPVSRKRARDYGESETRHRRATQEKFTAINRGGGGRIIEETTSKRGIGGYSSIQCLIQCDMKNLIGEASCRICQENFNTTVTGDIPYLCCKESSK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G324870`
TK1151 ID	TkA07G324870
OH-1004 ID	LXL04_031999
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G324870

Location Chr07:81347196-81348177 (-)

Description Similar to Os07g0631100: Transcription elongation factor 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0631100`	Transcription elongation factor implicated in the maintenance of proper chromatin structure in actively transcribed regions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031999 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0005634 nucleus Cellular Component

GO:0008023 transcription elongation factor complex Cellular Component

GO:0000993 RNA polymerase II complex binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0042393 histone binding Molecular Function

KEGG gene cross-reference

ath:AT5G46030

dosa:Os07g0631100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.914

Rank 1 · TkA07G324870 · TK1151

Cytoplasm0.146

Rank 2 · TkA07G324870 · TK1151

Cell membrane0.042

Rank 3 · TkA07G324870 · TK1151

Endoplasmic reticulum0.023

Rank 4 · TkA07G324870 · TK1151

Mitochondrion0.016

Rank 5 · TkA07G324870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05129Zn_ribbon_Elf149-96 aa

PF12344UvrB53-65 aa

PF12344UvrB75-86 aa

PF05129Zn_ribbon_Elf195-121 aa

PF12344UvrB110-118 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G324870	`PF05129`	Zn_ribbon_Elf1	49	96	0.0074	17.1
TkA07G324870	`PF12344`	UvrB	53	65	1.5	9.4
TkA07G324870	`PF12344`	UvrB	75	86	1.5	9.4
TkA07G324870	`PF05129`	Zn_ribbon_Elf1	95	121	0.0074	17.1
TkA07G324870	`PF12344`	UvrB	110	118	1.5	9.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LHP0`	Oryza sativa subsp. japonica	sp\|Q8LHP0\|ELOF1_ORYSJ Transcription elongation factor 1 homolog	80.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card