TkA07G309860 | RubberDandelionOmics

Gene overview

TkA07G309860

Reference: TK1151 Chr: Chr07 Coordinates: 77780843-77784011 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

696 bp · TkA07G309860|TK1151|cDNA

CCAAGTGAGGCTAACACATATGCAGACATAGAGGCAGTATACGAGTGTCTTGAGAGGGAGTATGGAGTTAGCCAAGAAGACATCATTCTTTACGGGCAGTCGGTCGGAAGTGGGCCCACACTGCACTTGGCTGCCCGCTTACCCAGGTTAAGAGGCGTGGTTCTTCACAGTGCTATTCTTTCTGGCCTTCGTGTTGTTTGCCATGTCAAATGCACACTTTGCTTTGATATATATAAGAATGTTAATAAAATCCGGAAGGT...

CDS

Download CDS FASTA

696 bp · TkA07G309860|TK1151|CDS

CCAAGTGAGGCTAACACATATGCAGACATAGAGGCAGTATACGAGTGTCTTGAGAGGGAGTATGGAGTTAGCCAAGAAGACATCATTCTTTACGGGCAGTCGGTCGGAAGTGGGCCCACACTGCACTTGGCTGCCCGCTTACCCAGGTTAAGAGGCGTGGTTCTTCACAGTGCTATTCTTTCTGGCCTTCGTGTTGTTTGCCATGTCAAATGCACACTTTGCTTTGATATATATAAGAATGTTAATAAAATCCGGAAGGT...

Protein

Download Protein FASTA

232 aa · TkA07G309860|TK1151|PROTEIN

PSEANTYADIEAVYECLEREYGVSQEDIILYGQSVGSGPTLHLAARLPRLRGVVLHSAILSGLRVVCHVKCTLCFDIYKNVNKIRKVKCPTLVIHGTEDDVVNWLHGNGLWKMAKDPYEPLWIKGGGHCNLELYPDYIRHLCRFIHEMETITTKTRLTKIKQILNSKPKKCSFCCIATWQPGCPECPRPRCPKCCKPSCGCFRWRKPKCPDVKLPKCPDCLRCSPCGCFMCS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G309860`
TK1151 ID	TkA07G309860
OH-1004 ID	LXL04_029394
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 87.879 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G309860`
Location	Chr07:77780843-77784011 (-)
Description	Similar to ABHD17B: Alpha/beta hydrolase domain-containing protein 17B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029394` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002084 protein depalmitoylation Biological Process GO:0072657 protein localization to membrane Biological Process GO:1902473 regulation of protein localization to synapse Biological Process GO:1902817 negative regulation of protein localization to microtubule Biological Process GO:1905668 positive regulation of protein localization to endosome Biological Process GO:0005886 plasma membrane Cellular Component GO:0010008 endosome membrane Cellular Component GO:0055038 recycling endosome membrane Cellular Component GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function
KEGG gene cross-reference	gga:415479 gga:427252 mmu:70178 rno:299617 rno:361601 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.621

Rank 1 · TkA07G309860 · TK1151

Cytoplasm0.241

Rank 2 · TkA07G309860 · TK1151

Nucleus0.126

Rank 3 · TkA07G309860 · TK1151

Extracellular0.111

Rank 4 · TkA07G309860 · TK1151

Endoplasmic reticulum0.085

Rank 5 · TkA07G309860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00326Peptidase_S94-48 aa

PF12697Abhydrolase_65-58 aa

PF12146Hydrolase_46-60 aa

PF01738DLH8-105 aa

PF00561Abhydrolase_110-58 aa

PF02129Peptidase_S1511-64 aa

PF08840BAAT_C14-83 aa

PF02230Abhydrolase_219-112 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G309860	`PF00326`	Peptidase_S9	4	48	0.0002	21.7
TkA07G309860	`PF12697`	Abhydrolase_6	5	58	0.0095	17.3
TkA07G309860	`PF12146`	Hydrolase_4	6	60	9.9e-07	29.0
TkA07G309860	`PF01738`	DLH	8	105	0.12	12.6
TkA07G309860	`PF00561`	Abhydrolase_1	10	58	9.7e-05	22.9
TkA07G309860	`PF02129`	Peptidase_S15	11	64	0.046	14.1
TkA07G309860	`PF08840`	BAAT_C	14	83	0.16	12.7
TkA07G309860	`PF02230`	Abhydrolase_2	19	112	0.0016	19.1
TkA07G309860	`PF20434`	BD-FAE	19	37	0.016	15.4
TkA07G309860	`PF03959`	FSH1	46	128	0.0067	16.9
TkA07G309860	`PF12695`	Abhydrolase_5	69	134	0.071	13.6
TkA07G309860	`PF00326`	Peptidase_S9	78	107	0.0002	21.7
TkA07G309860	`PF20434`	BD-FAE	79	108	0.016	15.4
TkA07G309860	`PF12697`	Abhydrolase_6	80	132	0.0095	17.3
TkA07G309860	`PF02129`	Peptidase_S15	82	130	0.046	14.1
TkA07G309860	`PF08840`	BAAT_C	82	103	0.16	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card