TkA07G308950 | RubberDandelionOmics

Gene overview

TkA07G308950

Reference: TK1151 Chr: Chr07 Coordinates: 77536613-77538186 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1080 bp · TkA07G308950|TK1151|cDNA

TTGAAAGTTAGATTAAACCTGAGAATATGACCAAACCAAAGGGACCAGTTCTTTAACTTGCTCTAAACTTTAGCTTCATTTGTATGATTGTATCCGATGCTCTCTGCCAGTTCCCGTCAACAAACGCTGCCATACTGTTGTTGAAAGAGTAAAAGGCTGCCGTAACCGATCTCAATCTCAAGTTCCGATGAACAACCGCGATGCTTCTACAGAGGCAACCATCGCCACTACACCTTCCGGACTGATCATCTCCAAAACAG...

CDS

Download CDS FASTA

648 bp · TkA07G308950|TK1151|CDS

ATGAACAACCGCGATGCTTCTACAGAGGCAACCATCGCCACTACACCTTCCGGACTGATCATCTCCAAAACAGAAGCCCTCCAATCATTTCTTTCTACCTCAATCAACAACCCTCACCTCTCCCCAGACCTCCGTCAGATCGCCTCATCCCTATCTGTCCAGCCCTCTTCCGTGCCCTACAAATCTCTTCGCTCGATTTGGGTCGACTCTGATCCATCAACTCGACCGCCTCTATCCGCCATCCTAACTGGCTCGCACTT...

Protein

Download Protein FASTA

215 aa · TkA07G308950|TK1151|PROTEIN

MNNRDASTEATIATTPSGLIISKTEALQSFLSTSINNPHLSPDLRQIASSLSVQPSSVPYKSLRSIWVDSDPSTRPPLSAILTGSHFILKSPQPREKSEELKARLRKYEEIAERKAYKELVKDITPKREESEPFSSYKDQLGFGLHVALTMFTGYLVGYATFRALFGHSPVMHAAGGILGLVVGMLVETVLFMIRTTSQDRKKTTFTASQIKKNQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G308950`
TK1151 ID	TkA07G308950
OH-1004 ID	LXL04_029385
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G308950`
Location	Chr07:77536613-77538186 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029385` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.668

Rank 1 · TkA07G308950 · TK1151

Nucleus0.180

Rank 2 · TkA07G308950 · TK1151

Cytoplasm0.118

Rank 3 · TkA07G308950 · TK1151

Golgi apparatus0.105

Rank 4 · TkA07G308950 · TK1151

Cell membrane0.070

Rank 5 · TkA07G308950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11712Vma1281-193 aa

PF22827GldL_N106-122 aa

PF02674Colicin_V120-210 aa

PF14362DUF4407136-202 aa

PF09527ATPase_gene1142-186 aa

PF01545Cation_efflux148-207 aa

PF22827GldL_N171-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G308950	`PF11712`	Vma12	81	193	3.9e-05	24.3
TkA07G308950	`PF22827`	GldL_N	106	122	0.0078	17.1
TkA07G308950	`PF02674`	Colicin_V	120	210	0.00071	20.3
TkA07G308950	`PF14362`	DUF4407	136	202	1.1	9.3
TkA07G308950	`PF09527`	ATPase_gene1	142	186	0.17	12.7
TkA07G308950	`PF01545`	Cation_efflux	148	207	0.012	16.1
TkA07G308950	`PF22827`	GldL_N	171	205	0.0078	17.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card