TkA07G307280 | RubberDandelionOmics

Gene overview

TkA07G307280

Reference: TK1151 Chr: Chr07 Coordinates: 77138595-77141297 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1785 bp · TkA07G307280|TK1151|cDNA

ATGCCCACAATAATACCAAAAGACACTCTTAACTGGAGGATAAAGTTAGTCGAATCAGCTGCTGCTTATGCTAACTCTCGTCTTCATACTATTACAGCTGAAGTCCTAGTGCTTGCAAGTGGTAAGGATAAACTCTTACCCAGTAAAAATGAAGCCCATAGGCTTTCAGGATTACTGAAGCACTGCAAGATACGTGTGTTTGAGGAAAATGGACACGCAATCCTCCTGGAGAGTGGCGTTAACGTGTTATCCGCTATAAA...

CDS

Download CDS FASTA

1785 bp · TkA07G307280|TK1151|CDS

ATGCCCACAATAATACCAAAAGACACTCTTAACTGGAGGATAAAGTTAGTCGAATCAGCTGCTGCTTATGCTAACTCTCGTCTTCATACTATTACAGCTGAAGTCCTAGTGCTTGCAAGTGGTAAGGATAAACTCTTACCCAGTAAAAATGAAGCCCATAGGCTTTCAGGATTACTGAAGCACTGCAAGATACGTGTGTTTGAGGAAAATGGACACGCAATCCTCCTGGAGAGTGGCGTTAACGTGTTATCCGCTATAAA...

Protein

Download Protein FASTA

594 aa · TkA07G307280|TK1151|PROTEIN

MPTIIPKDTLNWRIKLVESAAAYANSRLHTITAEVLVLASGKDKLLPSKNEAHRLSGLLKHCKIRVFEENGHAILLESGVNVLSAIKTTQMYRRLSNFDIFKDFLPPSMTEFKSVPMEAWWFRLYMGATMFSTMEDGKIVRGLAGIPDEGPVLIVGNHTLWGIDSFVLISEFMREKKIMLHGLAHPEIFRLVAEYEHTIMPFADIIKLSGAVPVSGRNFFKLLARKSYTLLYPGGVREAFHRKGFRQPSIGCINLVLSSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G307280`
TK1151 ID	TkA07G307280
OH-1004 ID	LXL04_034588
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 55.892 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G307280

Location Chr07:77138595-77141297 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54570`	Acyltransferase involved in fatty acid phytyl ester synthesis in chloroplasts, a process required for the maintenance of the photosynthetic membrane integrity during abiotic stress and senescence.	Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.2012 · DOI: 10.1105/tpc.112.095588
`At3g26840`	Acyltransferase involved in fatty acid phytyl ester synthesis in chloroplasts, a process required for the maintenance of the photosynthetic membrane integrity during abiotic stress and senescence.	Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.2012 · DOI: 10.1105/tpc.112.095588

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034588 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.498

Rank 1 · TkA07G307280 · TK1151

Nucleus0.234

Rank 2 · TkA07G307280 · TK1151

Mitochondrion0.135

Rank 3 · TkA07G307280 · TK1151

Endoplasmic reticulum0.119

Rank 4 · TkA07G307280 · TK1151

Peroxisome0.111

Rank 5 · TkA07G307280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146Hydrolase_420-78 aa

PF09412XendoU80-126 aa

PF01553Acyltransferase140-257 aa

PF07400IL11288-335 aa

PF30901PEG10-RTL1_C-capsid297-311 aa

PF03732PEG10_N-capsid343-413 aa

PF19259Ty3_capsid372-488 aa

PF21418LinB-like_C400-449 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G307280	`PF12146`	Hydrolase_4	20	78	0.015	15.3
TkA07G307280	`PF09412`	XendoU	80	126	0.13	12.1
TkA07G307280	`PF01553`	Acyltransferase	140	257	0.0041	17.6
TkA07G307280	`PF07400`	IL11	288	335	1.6	9.1
TkA07G307280	`PF30901`	PEG10-RTL1_C-capsid	297	311	2.3e-06	28.2
TkA07G307280	`PF03732`	PEG10_N-capsid	343	413	3.2e-12	47.3
TkA07G307280	`PF19259`	Ty3_capsid	372	488	3.9e-10	40.2
TkA07G307280	`PF21418`	LinB-like_C	400	449	0.16	12.5
TkA07G307280	`PF30901`	PEG10-RTL1_C-capsid	424	483	2.3e-06	28.2
TkA07G307280	`PF30314`	TP013X	444	494	0.24	10.9
TkA07G307280	`PF07400`	IL11	491	517	1.6	9.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVN2`	Arabidopsis thaliana	sp\|Q9ZVN2\|PES1_ARATH Phytyl ester synthase 1, chloroplastic	50.800%	Swiss-Prot	Low
`Q9LW26`	Arabidopsis thaliana	sp\|Q9LW26\|PES2_ARATH Phytyl ester synthase 2, chloroplastic	41.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card