TkA07G301820 | RubberDandelionOmics

Gene overview

TkA07G301820

Reference: TK1151 Chr: Chr07 Coordinates: 75809550-75815548 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · TkA07G301820|TK1151|cDNA

CCCCCCTCCATATACATATACTACTATCCACGCCCACCGTTTCACGATCAATTGTGGAGCACTGTTTATGCACACAATCTGTTTGTATAAATGCCCAAGTGGAATCTGAATACTTTTTTGATTAAGAAAGAAACCGGTAGAGTGGAAGTTACTTGAAGCTTCAGAGTTTGCTTATACTTGTTTTCCTTGCGGTGATTGATTGATCTATCGGTTTCTGTGTCGTTGAGGTGAGCTTCTCGGCTGCTTCGAAACTTTAATCT...

CDS

Download CDS FASTA

1155 bp · TkA07G301820|TK1151|CDS

ATGAAAAACTCTCATTTTGAATTCAATATATTTGGAACATGCAAGCGAATATCTGAGGGGATACATGAGCCTGAAAAAATGGAGCAATTTTCGACGTTTTTGAACGGAATCACAAAGAATATTACAACAAAAAACGTGAACAATAGGAGGATTAATCATGGAAGAGAAGCTACAAATGCTTTAGCCAAAGAGGCGAGAAAAAACGGTTTATTATTAACTTCTTCCGGTAACGTTAATGCTGAGTGGTCTAGTAATTACGT...

Protein

Download Protein FASTA

384 aa · TkA07G301820|TK1151|PROTEIN

MKNSHFEFNIFGTCKRISEGIHEPEKMEQFSTFLNGITKNITTKNVNNRRINHGREATNALAKEARKNGLLLTSSGNVNAEWSSNYVSAYSKGGNKGSNQDSFIVWESFGGKEDVMFCGVFDGHGPWGHVVGKRVKKVYPAYLLHYWREASSQRSILINGDQFAMWKKSFMKACSTVDYDLELHPIIDSFYSGTAGLTLVREGDLLVVANVGDSRAVLGTTSDDGSLVAVQLTVDFKPNLPQESERIYKAGGSVCEAEDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G301820`
TK1151 ID	TkA07G301820
OH-1004 ID	LXL04_029320
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G301820

Location Chr07:75809550-75815548 (-)

Description Similar to At3g05640: Probable protein phosphatase 2C 34

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05640`	Probable protein phosphatase 2C 34.	No verified direct reference in this release
`At5g27930`	Probable protein phosphatase 2C 73.	No verified direct reference in this release
`At3g16800`	Probable protein phosphatase 2C 41.	No verified direct reference in this release
`At3g02750`	Probable protein phosphatase 2C 33.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0358500`	Probable protein phosphatase 2C 48.	No verified direct reference in this release
`Os07g0566200`	Probable protein phosphatase 2C 64.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029320 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009819 drought recovery Biological Process

GO:0045926 negative regulation of growth Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G16220

ath:AT3G05640

ath:AT3G16800

ath:AT5G27930

dosa:Os05g0358500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.322

Rank 1 · TkA07G301820 · TK1151

Cytoplasm0.317

Rank 2 · TkA07G301820 · TK1151

Mitochondrion0.153

Rank 3 · TkA07G301820 · TK1151

Cell membrane0.126

Rank 4 · TkA07G301820 · TK1151

Endoplasmic reticulum0.108

Rank 5 · TkA07G301820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C94-351 aa

PF14834GST_C_4135-157 aa

PF14834GST_C_4319-357 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G301820	`PF00481`	PP2C	94	351	2.4e-40	139.5
TkA07G301820	`PF14834`	GST_C_4	135	157	0.028	15.2
TkA07G301820	`PF14834`	GST_C_4	319	357	0.028	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9W9`	Arabidopsis thaliana	sp\|Q9M9W9\|P2C34_ARATH Probable protein phosphatase 2C 34	54.500%	Swiss-Prot	High
`Q0WRB2`	Arabidopsis thaliana	sp\|Q0WRB2\|P2C73_ARATH Probable protein phosphatase 2C 73	52.400%	Swiss-Prot	High
`Q9LRZ4`	Arabidopsis thaliana	sp\|Q9LRZ4\|P2C41_ARATH Probable protein phosphatase 2C 41	50.100%	Swiss-Prot	High
`Q9M8R7`	Arabidopsis thaliana	sp\|Q9M8R7\|P2C33_ARATH Probable protein phosphatase 2C 33	41.900%	Swiss-Prot	Medium
`Q6L482`	Oryza sativa subsp. japonica	sp\|Q6L482\|P2C48_ORYSJ Probable protein phosphatase 2C 48	51.900%	Swiss-Prot	High
`Q8H4S6`	Oryza sativa subsp. japonica	sp\|Q8H4S6\|P2C64_ORYSJ Probable protein phosphatase 2C 64	45.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card