TkA07G297020 | RubberDandelionOmics

Gene overview

TkA07G297020

Reference: TK1151 Chr: Chr07 Coordinates: 74578988-74580317 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

519 bp · TkA07G297020|TK1151|CDS

ATGCTACCTGCAAGAGAAATTTTGCAAGAAGAAGAATGGACATGGAAGTCGCTACCAGAATCAAGATTTGACATGATGGCAGAGTCTCGTGAAACAAAGTCTTTCATCATTGCTTGCATAATCGATTCCCAGCTACTATCACCGCAAACAACATACGCAAGTTACCTCTTGTACAAACTTCCTCATAGTTACCGCTCAGTGTTTGAGGGACCAATAGAAGTAGAGAACATAGATCTCAAGATTGATTTCATAACACATAA...

Protein

Download Protein FASTA

172 aa · TkA07G297020|TK1151|PROTEIN

MLPAREILQEEEWTWKSLPESRFDMMAESRETKSFIIACIIDSQLLSPQTTYASYLLYKLPHSYRSVFEGPIEVENIDLKIDFITHKRLIYLITSPHVPVIRPQLDHLPHIPSSTRKIEGHPRLREDGWMELKVWEFPGDFATTISMRTCFKSCDRWKFTGLLIQGIEFRPL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G297020`
TK1151 ID	TkA07G297020
OH-1004 ID	LXL04_029285
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 22.964 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G297020

Location Chr07:74578988-74580317 (+)

Description Similar to HERK1: Receptor-like protein kinase HERK 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02240`	F-box protein At2g02240.	No verified direct reference in this release
`At2g02300`	F-box protein PP2-B5.	No verified direct reference in this release
`At1g80110`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029285 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009723 response to ethylene Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010038 response to metal ion Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

KEGG gene cross-reference

ath:AT1G30570

ath:AT3G46290

ath:AT3G51550

ath:AT5G38990

ath:AT5G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.557

Rank 1 · TkA07G297020 · TK1151

Nucleus0.486

Rank 2 · TkA07G297020 · TK1151

Cell membrane0.078

Rank 3 · TkA07G297020 · TK1151

Endoplasmic reticulum0.076

Rank 4 · TkA07G297020 · TK1151

Extracellular0.060

Rank 5 · TkA07G297020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14299PP29-171 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G297020	`PF14299`	PP2	9	171	1.9e-21	77.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E6P4`	Arabidopsis thaliana	sp\|Q3E6P4\|FB95_ARATH F-box protein At2g02240	34.600%	Swiss-Prot	Medium
`Q9ZVR1`	Arabidopsis thaliana	sp\|Q9ZVR1\|PP2B5_ARATH F-box protein PP2-B5	26.700%	Swiss-Prot	Low
`Q949S5`	Arabidopsis thaliana	sp\|Q949S5\|P2B11_ARATH F-box protein PP2-B11	29.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card