TkA07G284150 | RubberDandelionOmics

Gene overview

TkA07G284150

Reference: TK1151 Chr: Chr07 Coordinates: 71252083-71262073 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6004 bp · TkA07G284150|TK1151|cDNA

TTTTGGTATTGCTTTTCGATTAGCCATCAATGAACTTCAGTGTTGGAGTGCGGTTGCTCTGTTTGAGTTGATGATTTGAGAGTGAAGAGAAATGACATCGAGAGGGGGAGGTGGTGGTCCTTCGGATCAATTGTCGCCGCCGCAGCGGCGGATCATGCGGAAACAGGCAGCTGGGAATCTGGGAGAGTCGATATTTGATAGTGAAGTGGTGCCCTCGTCGTTGGTCGAGATTGCTCCTATCCTTCGTGTGGCTAATGAAG...

CDS

Download CDS FASTA

3639 bp · TkA07G284150|TK1151|CDS

ATGACATCGAGAGGGGGAGGTGGTGGTCCTTCGGATCAATTGTCGCCGCCGCAGCGGCGGATCATGCGGAAACAGGCAGCTGGGAATCTGGGAGAGTCGATATTTGATAGTGAAGTGGTGCCCTCGTCGTTGGTCGAGATTGCTCCTATCCTTCGTGTGGCTAATGAAGTTGAGCCCAGTAACCCCAGAGTTGCTTATCTTTGTCGGTTCTATGCATTTGAAAAAGCTCGTAGGTTGGATCCCACTTCTAGTGGACGTGG...

Protein

Download Protein FASTA

1212 aa · TkA07G284150|TK1151|PROTEIN

MTSRGGGGGPSDQLSPPQRRIMRKQAAGNLGESIFDSEVVPSSLVEIAPILRVANEVEPSNPRVAYLCRFYAFEKARRLDPTSSGRGVRQFKTALLQLLERENDRTLIRRMKKNDAREMQSLYRHYYSKYIQALQNAADKVDRAQLTKAYQTADVLFEVLKAVNLTYSMEVDKEILEAHDKVTQKTEIYLPYNILPLDRDSANQAIMRYPEIQATVVALRDTRGLPWPVHCRKKSGEDTLDWLQAMFGFQKDNVANQREH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G284150`
TK1151 ID	TkA07G284150
OH-1004 ID	LXL04_029196
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.600
Protein coverage (%)	TK1151 97.855 / OH-1004 60.727 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G284150

Location Chr07:71252083-71262073 (-)

Description Similar to CALS3: Callose synthase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13000`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At2g31960`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At1g05570`	Involved in callose synthesis at the forming cell plate during cytokinesis.	An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation.2003 · DOI: 10.1105/tpc.016097
`At2g13680`	Required for the formation of the callose wall separating the tetraspores (interstitial wall) and surrounding the pollen mother cells (peripheral wall).	Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02379.x Callose (beta-1,3 glucan) is essential for Arabidopsis pollen wall patterning, but not tube growth.2005 · DOI: 10.1186/1471-2229-5-22
`At5g36870`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029196 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0009555 pollen development Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0000148 1,3-beta-D-glucan synthase complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G05570

ath:AT2G13680

ath:AT2G31960

ath:AT5G13000

ath:AT5G36870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.666

Rank 1 · TkA07G284150 · TK1151

Cytoplasm0.144

Rank 2 · TkA07G284150 · TK1151

Endoplasmic reticulum0.118

Rank 3 · TkA07G284150 · TK1151

Nucleus0.109

Rank 4 · TkA07G284150 · TK1151

Golgi apparatus0.065

Rank 5 · TkA07G284150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04652Vta147-175 aa

PF02364Glucan_synthase86-170 aa

PF25968CALS191-114 aa

PF14288FKS1_dom1324-435 aa

PF17727CtsR_C806-827 aa

PF25968CALS1842-1021 aa

PF17727CtsR_C902-920 aa

PF21610FlgA_N947-984 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G284150	`PF04652`	Vta1	47	175	5.2e-16	59.7
TkA07G284150	`PF02364`	Glucan_synthase	86	170	1.5e-38	133.3
TkA07G284150	`PF25968`	CALS1	91	114	8.3e-64	215.3
TkA07G284150	`PF14288`	FKS1_dom1	324	435	6.6e-42	143.0
TkA07G284150	`PF17727`	CtsR_C	806	827	0.12	13.3
TkA07G284150	`PF25968`	CALS1	842	1021	8.3e-64	215.3
TkA07G284150	`PF17727`	CtsR_C	902	920	0.12	13.3
TkA07G284150	`PF21610`	FlgA_N	947	984	0.29	11.7
TkA07G284150	`PF02364`	Glucan_synthase	1028	1118	1.5e-38	133.3
TkA07G284150	`PF02364`	Glucan_synthase	1124	1168	1.5e-38	133.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXT9`	Arabidopsis thaliana	sp\|Q9LXT9\|CALS3_ARATH Callose synthase 3	72.000%	Swiss-Prot	High
`Q9SL03`	Arabidopsis thaliana	sp\|Q9SL03\|CALS2_ARATH Callose synthase 2	67.800%	Swiss-Prot	High
`Q9AUE0`	Arabidopsis thaliana	sp\|Q9AUE0\|CALS1_ARATH Callose synthase 1	68.000%	Swiss-Prot	High
`Q3B724`	Arabidopsis thaliana	sp\|Q3B724\|CALS5_ARATH Callose synthase 5	53.700%	Swiss-Prot	High
`Q9LTG5`	Arabidopsis thaliana	sp\|Q9LTG5\|CALS4_ARATH Callose synthase 4	53.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card