TkA07G272110 | RubberDandelionOmics

Gene overview

TkA07G272110

Reference: TK1151 Chr: Chr07 Coordinates: 68021070-68022775 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1106 bp · TkA07G272110|TK1151|cDNA

AAGTCGGATAAGGGTGTATTATTAGAACGTTTTTGACTTATGATGAAAGCATGAAAATGAAAGGTGATATTTTTCAACCACAACCGCCCATCTCCCCTTATGTCTTTAAATATTCGGCTCTGCTAATTTGATACTATCAATCTCTTTGAAAACCCCCTTTCAAGAGTTTATAAAAAAAAAGATGAGCCCTAAATTGATACTTCTCATGCTTTTGATACCTTACGTGTCATCTTCCTCACAAGATACCGCCTACCCACCTC...

CDS

Download CDS FASTA

780 bp · TkA07G272110|TK1151|CDS

ATGAGCCCTAAATTGATACTTCTCATGCTTTTGATACCTTACGTGTCATCTTCCTCACAAGATACCGCCTACCCACCTCCATATGGCGAAGAGTTGATTCCTTTAAGAAGGGATGTTTACTCAAGTGGGAAAATTTACGATATTACCCATAGCGTTTCTCCAGGAACACTCTCAGGGGTTTCTGATGTAGGAATCGGGGAGTACCTTACACCATTTCGAAGCATGAAAAATGGATCCGATTATAACTTCTCCATCATAAA...

Protein

Download Protein FASTA

259 aa · TkA07G272110|TK1151|PROTEIN

MSPKLILLMLLIPYVSSSSQDTAYPPPYGEELIPLRRDVYSSGKIYDITHSVSPGTLSGVSDVGIGEYLTPFRSMKNGSDYNFSIIKLPAHSGTHVDAPGHFYENYFEAGFDVDSLDLQVLNGPALLVDVPRDKNITAEVMESLNIPKGVRRVLFRTLNTDKQLMTQKRFDSSYVGFMKDGAQWLKDNTDIKLVGTDYLSVAAHDDLIPAHLVFLESREIILVEGLKLEDVEAGLYNVHCLPLRLLGAEGSPIRCILIK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G272110`
TK1151 ID	TkA07G272110
OH-1004 ID	LXL04_029095
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G272110

Location Chr07:68021070-68022775 (-)

Description Similar to CYCLASE2: Cyclase-like protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35220`	May function redundantly with CYCLASE1 for normal plant growth, development and viability.	No verified direct reference in this release
`At4g34180`	Acts as a negative regulator of fumonisin B1- and pathogen-induced programmed cell death (PCD), and regulates pathogen-induced symptom development.	A Novel Function for Arabidopsis CYCLASE1 in Programmed Cell Death Revealed by Isobaric Tags for Relative and Absolute Quantitation (iTRAQ) Analysis of Extracellular Matrix Proteins.2015 · DOI: 10.1074/mcp.m114.045054
`At1g44542`	Cyclase-like protein 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0319900`	May be involved in response to stresses.	No verified direct reference in this release
`Os09g0110300`	May be involved in the control of plant responses to environmental stresses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029095 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0019441 L-tryptophan catabolic process to L-kynurenine Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G44542

ath:AT4G34180

ath:AT4G35220

dosa:Os08g0319900

dosa:Os09g0110300

osa:4345252

osa:4346391

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.367

Rank 1 · TkA07G272110 · TK1151

Extracellular0.273

Rank 2 · TkA07G272110 · TK1151

Endoplasmic reticulum0.190

Rank 3 · TkA07G272110 · TK1151

Cytoplasm0.166

Rank 4 · TkA07G272110 · TK1151

Cell membrane0.100

Rank 5 · TkA07G272110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04199Cyclase46-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G272110	`PF04199`	Cyclase	46	201	2e-19	70.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94JT5`	Arabidopsis thaliana	sp\|Q94JT5\|CYL2_ARATH Cyclase-like protein 2	66.800%	Swiss-Prot	High
`Q93V74`	Arabidopsis thaliana	sp\|Q93V74\|CYL1_ARATH Cyclase-like protein 1	66.500%	Swiss-Prot	High
`Q94LA9`	Arabidopsis thaliana	sp\|Q94LA9\|CYL3_ARATH Cyclase-like protein 3	63.900%	Swiss-Prot	High
`Q0J6H8`	Oryza sativa subsp. japonica	sp\|Q0J6H8\|CYL3_ORYSJ Cyclase-like protein 3	64.000%	Swiss-Prot	High
`Q6YX89`	Oryza sativa subsp. japonica	sp\|Q6YX89\|CYL4_ORYSJ Cyclase-like protein 4	60.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card