TkA07G268890 | RubberDandelionOmics

Gene overview

TkA07G268890

Reference: TK1151 Chr: Chr07 Coordinates: 67169024-67170247 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1112 bp · TkA07G268890|TK1151|cDNA

CTGGTATATCGGCGAACGGTTGTAGAAGAGAGCGATAAAGGAGGTATTGACTAAGTTTATACCACGACGACGGAAAACAGTTCACTGGTTGAAAGAGTTTGCAATAGAGACTTGTACAATAGCCTTAATATGTTGTAAGTCTTAAAAATTCAGCCAAAAGCCTTGTTTCCTTTATTAAGTAGTATAGATGACCAATATGCCATTTAATTAAATATGAAAGATATAATATCCATGAGGACCAACTCACATTTATATCCAAA...

CDS

Download CDS FASTA

450 bp · TkA07G268890|TK1151|CDS

ATGGAGGTTCTAAAGAACAAAAACCTCATCAACACCGAAGTTTCAAAGCGAGTCCACATCATCTACAGCCTCTCCAAAGACCTCGGTCTACTAGGTTTCCGAGTCGGAGCAATTTACTCCGGCAACGACGACGTCGTCGCCGCCGCAACAAAAATGTCGAGCTTCGGATTAGTTTCGTCGCAAACTCAGTATCTACTCTGGGAGATGTTATCCGACCGGAAGTTCACAAAGCTCTATCTTTCTGAGAATAGCCGGAGACT...

Protein

Download Protein FASTA

150 aa · TkA07G268890|TK1151|PROTEIN

MEVLKNKNLINTEVSKRVHIIYSLSKDLGLLGFRVGAIYSGNDDVVAAATKMSSFGLVSSQTQYLLWEMLSDRKFTKLYLSENSRRLNTPARNARKGASEGRNPVPERERQFVLLGGYETSFDLTDFSRRTGAMGEDCVRCPVEHLAPFI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G268890`
TK1151 ID	TkA07G268890
OH-1004 ID	LXL04_029063
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 67.568 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G268890

Location Chr07:67169024-67170247 (-)

Description Similar to ACS9: 1-aminocyclopropane-1-carboxylate synthase 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49700`	1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene.	No verified direct reference in this release
`At5g65800`	1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene.	No verified direct reference in this release
`At2g22810`	1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029063 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0006520 amino acid metabolic process Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009733 response to auxin Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009835 fruit ripening Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0051301 cell division Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0008483 transaminase activity Molecular Function

GO:0016847 1-aminocyclopropane-1-carboxylate synthase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

KEGG gene cross-reference

ath:AT2G22810

ath:AT3G49700

ath:AT4G37770

ath:AT5G65800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.374

Rank 1 · TkA07G268890 · TK1151

Mitochondrion0.212

Rank 2 · TkA07G268890 · TK1151

Nucleus0.209

Rank 3 · TkA07G268890 · TK1151

Peroxisome0.133

Rank 4 · TkA07G268890 · TK1151

Cell membrane0.057

Rank 5 · TkA07G268890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00155Aminotran_1_213-117 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G268890	`PF00155`	Aminotran_1_2	13	117	5.2e-18	66.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2Y8`	Arabidopsis thaliana	sp\|Q9M2Y8\|1A19_ARATH 1-aminocyclopropane-1-carboxylate synthase 9	77.000%	Swiss-Prot	Medium
`Q37001`	Arabidopsis thaliana	sp\|Q37001\|1A15_ARATH 1-aminocyclopropane-1-carboxylate synthase 5	70.700%	Swiss-Prot	Medium
`Q43309`	Arabidopsis thaliana	sp\|Q43309\|1A14_ARATH 1-aminocyclopropane-1-carboxylate synthase 4	73.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card