TkA07G264100 | RubberDandelionOmics

Gene overview

TkA07G264100

Reference: TK1151 Chr: Chr07 Coordinates: 66008094-66013929 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1255 bp · TkA07G264100|TK1151|cDNA

GTCACAACAAAATCATTACTTCTCATTATAATATCTTTTTTTCTAGATTTCAAAATGAACGGTAATAGTGTGGTCTTGGGAAAAAGGGTGTCTCACTTGCTATTAAAGCAGTTGGAAACCCGTTTGTTTTTCACGGGTTTTACCCATTCCACCATCCGTGAATCCTCCAAAATTCCTAGGGATACTAGTATCGAAACAAGTACGGTTTCTATAATGCATGCTCGTAAATGGAGCACGTTTACTTCTACAAATTCAAACAT...

CDS

Download CDS FASTA

993 bp · TkA07G264100|TK1151|CDS

ATGAACGGTAATAGTGTGGTCTTGGGAAAAAGGGTGTCTCACTTGCTATTAAAGCAGTTGGAAACCCGTTTGTTTTTCACGGGTTTTACCCATTCCACCATCCGTGAATCCTCCAAAATTCCTAGGGATACTAGTATCGAAACAAGTACGGTTTCTATAATGCATGCTCGTAAATGGAGCACGTTTACTTCTACAAATTCAAACATCGATAAAAAAGAGGAAAACAATCAAAAAGCCATCTCAAGCTATTGGGGTGTAAC...

Protein

Download Protein FASTA

330 aa · TkA07G264100|TK1151|PROTEIN

MNGNSVVLGKRVSHLLLKQLETRLFFTGFTHSTIRESSKIPRDTSIETSTVSIMHARKWSTFTSTNSNIDKKEENNQKAISSYWGVTPPSLTKADGSAWKWNSFRPWEAYVADTSIDVTKHHKPVTWNDKIAFWIVQALKYPTYFYFQKKHIHHAVLLETVAAVPGMVGGMLLHTKSLRRFEQSGGWIKALLEEAENERMHLMTFIDVYEPKWHERLLVFAVQGVFFNAYFLAYLASPKLAHRITGYLEEEAVNSYTEFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G264100`
TK1151 ID	TkA07G264100
OH-1004 ID	LXL04_029036
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	71.100
Protein coverage (%)	TK1151 76.667 / OH-1004 73.761 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G264100

Location Chr07:66008094-66013929 (+)

Description Similar to AOX1: Ubiquinol oxidase 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32350`	Catalyzes the cyanide-resistant oxidation of ubiquinol and the reduction of molecular oxygen to water, but does not translocate protons and consequently is not linked to oxidative phosphorylation.	No verified direct reference in this release
`At3g22370`	Catalyzes the cyanide-resistant oxidation of ubiquinol and the reduction of molecular oxygen to water, but does not translocate protons and consequently is not linked to oxidative phosphorylation.	The alternative oxidase of plant mitochondria is involved in the acclimation of shoot growth at low temperature. A study of Arabidopsis AOX1a transgenic plants.2005 · DOI: 10.1104/pp.105.070789

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0600300`	Catalyzes the cyanide-resistant oxidation of ubiquinol and the reduction of molecular oxygen to water, but does not translocate protons and consequently is not linked to oxidative phosphorylation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029036 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0010230 alternative respiration Biological Process

GO:0022904 respiratory electron transport chain Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0045333 cellular respiration Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009916 alternative oxidase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0102721 ubiquinol:oxygen oxidoreductase activity Molecular Function

GO:0106292 superoxide-generating NADPH oxidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G22360

ath:AT3G22370

gmx:547924

nta:107781761

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.944

Rank 1 · TkA07G264100 · TK1151

Cytoplasm0.052

Rank 2 · TkA07G264100 · TK1151

Nucleus0.048

Rank 3 · TkA07G264100 · TK1151

Cell membrane0.034

Rank 4 · TkA07G264100 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA07G264100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01786AOX119-311 aa

PF06479Ribonuc_2-5A126-144 aa

PF03232COQ7190-308 aa

PF06479Ribonuc_2-5A258-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G264100	`PF01786`	AOX	119	311	7.7e-77	258.5
TkA07G264100	`PF06479`	Ribonuc_2-5A	126	144	0.18	12.7
TkA07G264100	`PF03232`	COQ7	190	308	0.00074	19.9
TkA07G264100	`PF06479`	Ribonuc_2-5A	258	310	0.18	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LEE7`	Arabidopsis thaliana	sp\|Q8LEE7\|AOX3_ARATH Ubiquinol oxidase 3, mitochondrial	75.100%	Swiss-Prot	High
`Q39219`	Arabidopsis thaliana	sp\|Q39219\|AOX1A_ARATH Ubiquinol oxidase 1a, mitochondrial	70.800%	Swiss-Prot	High
`O82766`	Oryza sativa subsp. japonica	sp\|O82766\|AOX1B_ORYSJ Ubiquinol oxidase 1b, mitochondrial	70.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card