TkA07G260850 | RubberDandelionOmics

Gene overview

TkA07G260850

Reference: TK1151 Chr: Chr07 Coordinates: 65209512-65213486 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2719 bp · TkA07G260850|TK1151|cDNA

ATAAACACTGTTTTGTTTTATCGGAACGGGAAAAGTTTGCCCTCTCTTTACTTTCCTTTTCTTGTTCTTAAGTCTCCATTGATGAATTGATACGTAGATTCATGGAATCACAGACGCAGCAATACCCCAATAACAATATCAATCATCACCAACAACGATCCTACGGAGGAAGAGGGAGTTCAAGCACAAGCACAAGCACCGCAACAATGGAAATGGCGAGACAACCCTCACAGCAGCACTCCGACAACGACAGGAGCAGC...

CDS

Download CDS FASTA

2460 bp · TkA07G260850|TK1151|CDS

ATGGAATCACAGACGCAGCAATACCCCAATAACAATATCAATCATCACCAACAACGATCCTACGGAGGAAGAGGGAGTTCAAGCACAAGCACAAGCACCGCAACAATGGAAATGGCGAGACAACCCTCACAGCAGCACTCCGACAACGACAGGAGCAGCGGGGAACTCCACGCACTCGATTGTAACCTCACTTCCTTATGTGATCATATTCAAATGGAAGGTTTCAACAATGGATCGTTCTCAGATGTAGTCGTTCAGGC...

Protein

Download Protein FASTA

819 aa · TkA07G260850|TK1151|PROTEIN

MESQTQQYPNNNINHHQQRSYGGRGSSSTSTSTATMEMARQPSQQHSDNDRSSGELHALDCNLTSLCDHIQMEGFNNGSFSDVVVQAMGATYHLHRLILSRSSYFRNMLHGPWKDANAPVLTLHVDDNNVNREAIAIALSYLYGNHPKLDDSNAFRVLAAASFLDLQNLCAICTDFIISELWTTNLLAYQVFAEGQNYGEHGERVRNACWGYLCQSGAMELKEVLPKLSSQTLHALLTSDELWVPSEEKRFELALYILLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G260850`
TK1151 ID	TkA07G260850
OH-1004 ID	LXL04_029003
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G260850`
Location	Chr07:65209512-65213486 (-)
Description	Similar to Gmcl1: Germ cell-less protein-like 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029003` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0007278 pole cell fate determination Biological Process GO:0007279 pole cell formation Biological Process GO:0007281 germ cell development Biological Process GO:0007283 spermatogenesis Biological Process GO:0016480 negative regulation of transcription by RNA polymerase III Biological Process GO:0016567 protein ubiquitination Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045892 negative regulation of DNA-templated transcription Biological Process GO:0050801 monoatomic ion homeostasis Biological Process
KEGG gene cross-reference	dme:Dmel_CG8411 hsa:64395 hsa:64396 mmu:23885 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.496

Rank 1 · TkA07G260850 · TK1151

Nucleus0.469

Rank 2 · TkA07G260850 · TK1151

Cell membrane0.093

Rank 3 · TkA07G260850 · TK1151

Mitochondrion0.061

Rank 4 · TkA07G260850 · TK1151

Endoplasmic reticulum0.052

Rank 5 · TkA07G260850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651BTB75-179 aa

PF23998BTB_BTBDG82-103 aa

PF11822BTB_SANBR97-172 aa

PF23998BTB_BTBDG120-175 aa

PF07707BACK225-255 aa

PF20735Lambda_ea8_5246-271 aa

PF20735Lambda_ea8_5487-500 aa

PF23998BTB_BTBDG699-736 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G260850	`PF00651`	BTB	75	179	7.2e-15	55.8
TkA07G260850	`PF23998`	BTB_BTBDG	82	103	2.3e-05	25.4
TkA07G260850	`PF11822`	BTB_SANBR	97	172	0.11	13.5
TkA07G260850	`PF23998`	BTB_BTBDG	120	175	2.3e-05	25.4
TkA07G260850	`PF07707`	BACK	225	255	0.077	13.8
TkA07G260850	`PF20735`	Lambda_ea8_5	246	271	0.3	12.4
TkA07G260850	`PF20735`	Lambda_ea8_5	487	500	0.3	12.4
TkA07G260850	`PF23998`	BTB_BTBDG	699	736	2.3e-05	25.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card