TkA07G255290 | RubberDandelionOmics

Gene overview

TkA07G255290

Reference: TK1151 Chr: Chr07 Coordinates: 63824208-63824705 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · TkA07G255290|TK1151|cDNA

CGTCGATCCTCTCCCACCTCCCGCATACCCATTCAACTTCACCAAAAACTCACTCCCGCTCGAACTGATATCTCCATCGCTAGGGTTTATCTTTCTCCGGCCTCTGCTACCTGCGACGAGCCCGAACACTTCATCTCCCCCGCTGCGACGCCGACTTTCGAGCTCAACGCCGATAATACGAACTGCGACGGTGGGATTTCACGAAGCAGCTACCTAGGGTTTCAGAAATTCGATTTTTGGGCGGTTTCCAGGTATTGTGT...

CDS

Download CDS FASTA

498 bp · TkA07G255290|TK1151|CDS

CGTCGATCCTCTCCCACCTCCCGCATACCCATTCAACTTCACCAAAAACTCACTCCCGCTCGAACTGATATCTCCATCGCTAGGGTTTATCTTTCTCCGGCCTCTGCTACCTGCGACGAGCCCGAACACTTCATCTCCCCCGCTGCGACGCCGACTTTCGAGCTCAACGCCGATAATACGAACTGCGACGGTGGGATTTCACGAAGCAGCTACCTAGGGTTTCAGAAATTCGATTTTTGGGCGGTTTCCAGGTATTGTGT...

Protein

Download Protein FASTA

165 aa · TkA07G255290|TK1151|PROTEIN

RRSSPTSRIPIQLHQKLTPARTDISIARVYLSPASATCDEPEHFISPAATPTFELNADNTNCDGGISRSSYLGFQKFDFWAVSRYCVSLKPLKPDLISTFVIFILSTPTDLLSLLMVVSFHKPPSSRRTRIETLKRSFDYISTSAQTLFLGTDFYSFFFTSTAFT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G255290`
TK1151 ID	TkA07G255290
OH-1004 ID	LXL04_002659
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.800
Protein coverage (%)	TK1151 78.788 / OH-1004 40.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G255290`
Location	Chr07:63824208-63824705 (-)
Description	Similar to At1g30630: Coatomer subunit epsilon-1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002659` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process GO:0006891 intra-Golgi vesicle-mediated transport Biological Process GO:0015031 protein transport Biological Process GO:0000139 Golgi membrane Cellular Component GO:0000325 plant-type vacuole Cellular Component GO:0030126 COPI vesicle coat Cellular Component GO:0005198 structural molecule activity Molecular Function
KEGG gene cross-reference	ath:AT1G30630 ath:AT2G34840 dosa:Os04g0612600 dosa:Os04g0644700 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.339

Rank 1 · TkA07G255290 · TK1151

Nucleus0.319

Rank 2 · TkA07G255290 · TK1151

Mitochondrion0.215

Rank 3 · TkA07G255290 · TK1151

Cell membrane0.067

Rank 4 · TkA07G255290 · TK1151

Endoplasmic reticulum0.057

Rank 5 · TkA07G255290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH117-142 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G255290	`PF00010`	HLH	117	142	0.15	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card