TkA07G252740 | RubberDandelionOmics

Gene overview

TkA07G252740

Reference: TK1151 Chr: Chr07 Coordinates: 63062269-63062832 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

564 bp · TkA07G252740|TK1151|cDNA

ATGGAGAAAACACGGATACAAAAAGCAATAAGCCAAACATTCCAAAGCACGGCCCACTTAGCGAATCTTTTACCCACTGGGTCAGTTCTTGCTTTTCAGGTTCTTTCGCCAATATCCACAAATGAGGGTGAGTGCGATCATGTCAGCCGGGCCATGACTGCTACACTTGTAGCTCTTTGTGGGTTTTCGTGTTTTCTGCTTAATTTCACCGACAGTTTCATGGATGCTAAGGGAAATGTTTGTTATGGATTCGCGACAAC...

CDS

Download CDS FASTA

564 bp · TkA07G252740|TK1151|CDS

ATGGAGAAAACACGGATACAAAAAGCAATAAGCCAAACATTCCAAAGCACGGCCCACTTAGCGAATCTTTTACCCACTGGGTCAGTTCTTGCTTTTCAGGTTCTTTCGCCAATATCCACAAATGAGGGTGAGTGCGATCATGTCAGCCGGGCCATGACTGCTACACTTGTAGCTCTTTGTGGGTTTTCGTGTTTTCTGCTTAATTTCACCGACAGTTTCATGGATGCTAAGGGAAATGTTTGTTATGGATTCGCGACAAC...

Protein

Download Protein FASTA

187 aa · TkA07G252740|TK1151|PROTEIN

MEKTRIQKAISQTFQSTAHLANLLPTGSVLAFQVLSPISTNEGECDHVSRAMTATLVALCGFSCFLLNFTDSFMDAKGNVCYGFATTSGLWIIDGSTTLPKELAAKYRLRLLDFMHAFMSLMVFAAVALFNQDVVNCFYPSPSHEATEILTTLPVAVGVFLSMLFVAFPTQRHGIGFPVSTVMTAAS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G252740`
TK1151 ID	TkA07G252740
OH-1004 ID	LXL04_019960
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	57.500
Protein coverage (%)	TK1151 92.513 / OH-1004 85.294 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G252740

Location Chr07:63062269-63062832 (+)

Description Similar to DMP4: Protein DMP4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18425`	Involved in membrane remodeling.	No verified direct reference in this release
`At5g46090`	Involved in membrane remodeling.	No verified direct reference in this release
`At4g28485`	Involved in membrane remodeling.	No verified direct reference in this release
`At4g24310`	Involved in membrane remodeling.	No verified direct reference in this release
`At3g02430`	Involved in membrane remodeling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019960 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009838 abscission Biological Process

GO:0009900 dehiscence Biological Process

GO:0010256 endomembrane system organization Biological Process

GO:0090693 plant organ senescence Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

KEGG gene cross-reference

ath:AT3G02430

ath:AT4G18425

ath:AT4G24310

ath:AT4G28485

ath:AT5G46090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.324

Rank 1 · TkA07G252740 · TK1151

Lysosome / Vacuole0.319

Rank 2 · TkA07G252740 · TK1151

Endoplasmic reticulum0.277

Rank 3 · TkA07G252740 · TK1151

Cytoplasm0.190

Rank 4 · TkA07G252740 · TK1151

Golgi apparatus0.142

Rank 5 · TkA07G252740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05078DUF67915-177 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G252740	`PF05078`	DUF679	15	177	1.1e-70	237.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L928`	Arabidopsis thaliana	sp\|Q8L928\|DMP4_ARATH Protein DMP4	69.700%	Swiss-Prot	High
`Q9FNL3`	Arabidopsis thaliana	sp\|Q9FNL3\|DMP6_ARATH Protein DMP6	69.500%	Swiss-Prot	High
`Q5XV67`	Arabidopsis thaliana	sp\|Q5XV67\|DMP7_ARATH Protein DMP7	52.000%	Swiss-Prot	High
`Q9STW3`	Arabidopsis thaliana	sp\|Q9STW3\|DMP3_ARATH Protein DMP3	46.700%	Swiss-Prot	Medium
`Q9M897`	Arabidopsis thaliana	sp\|Q9M897\|DMP5_ARATH Protein DMP5	47.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card