TkA07G251990 | RubberDandelionOmics

Gene overview

TkA07G251990

Reference: TK1151 Chr: Chr07 Coordinates: 62844488-62846505 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1677 bp · TkA07G251990|TK1151|cDNA

ATGGAGGATAATATGGCTGCTAAAGGAGCTGAGCCTGTTGAAAATGAAGGGGCAAATTCTGTTGAAGAAGGAAGTGAAACAGATGTGGATGAAGGAAGTGAAACAGATGACAGTGAATACTGGGTGGATGAAGATAACATCATTGATGATGTTGAAGTTGATATGAGGGAGTTCCATTTGAACATTGATACAGAGGCTGAGTTCTTGGAGGCTAGGGCTAGGAAATCGAATGACCAAGTAAGTGATGCAGAACCTGGTGA...

CDS

Download CDS FASTA

1677 bp · TkA07G251990|TK1151|CDS

ATGGAGGATAATATGGCTGCTAAAGGAGCTGAGCCTGTTGAAAATGAAGGGGCAAATTCTGTTGAAGAAGGAAGTGAAACAGATGTGGATGAAGGAAGTGAAACAGATGACAGTGAATACTGGGTGGATGAAGATAACATCATTGATGATGTTGAAGTTGATATGAGGGAGTTCCATTTGAACATTGATACAGAGGCTGAGTTCTTGGAGGCTAGGGCTAGGAAATCGAATGACCAAGTAAGTGATGCAGAACCTGGTGA...

Protein

Download Protein FASTA

558 aa · TkA07G251990|TK1151|PROTEIN

MEDNMAAKGAEPVENEGANSVEEGSETDVDEGSETDDSEYWVDEDNIIDDVEVDMREFHLNIDTEAEFLEARARKSNDQVSDAEPGELDVIDNDAFDSLEEDSDQGRKRRAILKQIGKEKTFSLGEVHTWKFHDKKRLRAICKGKVAFTEPEVDKSKAKKSKGKKQSKKQSKGNKKTKADSCPWILHASRSTEESSWYIKTYEQVHTCLNSRKIKAATAKFLSNQIVDQLESNPKVPVKALQEQLMKKYKVGFSKHKIFR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G251990`
TK1151 ID	TkA07G251990
OH-1004 ID	LXL04_000461
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	86.600
Protein coverage (%)	TK1151 100.000 / OH-1004 57.196 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G251990`
Location	Chr07:62844488-62846505 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000461` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.942

Rank 1 · TkA07G251990 · TK1151

Cytoplasm0.114

Rank 2 · TkA07G251990 · TK1151

Cell membrane0.021

Rank 3 · TkA07G251990 · TK1151

Mitochondrion0.016

Rank 4 · TkA07G251990 · TK1151

Endoplasmic reticulum0.015

Rank 5 · TkA07G251990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10302Dsc3_N133-180 aa

PF08731AFT155-207 aa

PF22219DUF3829_2nd221-280 aa

PF00872Transposase_mut239-258 aa

PF10551MULE318-413 aa

PF00872Transposase_mut332-424 aa

PF10302Dsc3_N387-412 aa

PF13877RPAP3_C435-488 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G251990	`PF10302`	Dsc3_N	133	180	0.037	15.3
TkA07G251990	`PF08731`	AFT	155	207	0.024	15.6
TkA07G251990	`PF22219`	DUF3829_2nd	221	280	0.065	14.0
TkA07G251990	`PF00872`	Transposase_mut	239	258	3.7e-06	26.8
TkA07G251990	`PF10551`	MULE	318	413	4.4e-21	75.8
TkA07G251990	`PF00872`	Transposase_mut	332	424	3.7e-06	26.8
TkA07G251990	`PF10302`	Dsc3_N	387	412	0.037	15.3
TkA07G251990	`PF13877`	RPAP3_C	435	488	0.18	13.1
TkA07G251990	`PF22219`	DUF3829_2nd	532	550	0.065	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card