TkA07G166140 | RubberDandelionOmics

Gene overview

TkA07G166140

Reference: TK1151 Chr: Chr07 Coordinates: 42649491-42654776 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2145 bp · TkA07G166140|TK1151|cDNA

ATAACTCGGTATCGTAACAATTTCACTCCTATTTATTATCACCAAAATGAATGACTTAAAAGAAAATTTGGAATTAAACATTTTTGGGGGTCTTTAAAATGTAAATCCGCCGCTATTTAAGCCCGATAACTCCACCGAAGATAGTGTAAGTGAGAGAAACAAAAAAGATTACTTTAGATTCTGTAGCAGCGGCAGATTACGAAAGTGTTGTTGTAGTATAGCCAACCCCAACCCAAATCCAACCCTTTCAGAGAGAGAAA...

CDS

Download CDS FASTA

1266 bp · TkA07G166140|TK1151|CDS

ATGATAGCTTATTTAGAGCATTTCGTTCACGAGAACGACTCCGAAGCCATGCTTCAACAAGAAGACGAAGAAGCCGCAACTAGATTATGCCAAGCCATGGACCTCGAAGGCACTATCGATTACAGGTCTACCGCCTATGCCGGAAAAGACTTCGGCGGCTTGCATGCATCCACGCCGTTCGCCGTCATCAGACCTTCCGGCAGCCACGACATCGCGAGTGTTATCAGATTTGCGTCTCAATCGCCGAATCTGACGGTGGC...

Protein

Download Protein FASTA

421 aa · TkA07G166140|TK1151|PROTEIN

MIAYLEHFVHENDSEAMLQQEDEEAATRLCQAMDLEGTIDYRSTAYAGKDFGGLHASTPFAVIRPSGSHDIASVIRFASQSPNLTVAARGNGHSINGQAMANKGLILDMKESSDAVIDLVHYADGYAVDVGGGALWEDVLRWCVSEFGFSPRSWTDYLGLTVGGTLSNAGVSGQTFRYGPQTSNVTELEVVTGNGDTVICSDTQNSELFFSVLGGLGQFGIITRARVLVQPAPDMVRWIRVVYSEFDEFTRDAESLITQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G166140`
TK1151 ID	TkA07G166140
OH-1004 ID	LXL04_028533
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.800
Protein coverage (%)	TK1151 95.962 / OH-1004 77.692 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G166140

Location Chr07:42649491-42654776 (-)

Description Similar to CKX7: Cytokinin dehydrogenase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g21482`	Catalyzes the oxidation of cytokinins, a family of N(6)-substituted adenine derivatives that are plant hormones, where the substituent is an isopentenyl group.	No verified direct reference in this release
`At2g41510`	May catalyze oxidative degradation of cytokinins.	Vacuolar and cytosolic cytokinin dehydrogenases of Arabidopsis thaliana: heterologous expression, purification and properties.2010 · DOI: 10.1016/j.phytochem.2010.08.013 Jasmonate inhibits adventitious root initiation through repression of CKX1 and activation of RAP2.6L transcription factor in Arabidopsis.2021 · DOI: 10.1093/jxb/erab358 Cytokinin regulates female gametophyte development by cell cycle modulation in Arabidopsis thaliana.2022 · DOI: 10.1016/j.plantsci.2022.111419

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0460600`	May catalyze oxidative degradation of cytokinins.	Cytokinin oxidase/dehydrogenase OsCKX11 coordinates source and sink relationship in rice by simultaneous regulation of leaf senescence and grain number.2021 · DOI: 10.1111/pbi.13467
`Os01g0775400`	Catalyzes the oxidation of cytokinins, a family of N(6)-substituted adenine derivatives that are plant hormones, where the substituent is an isopentenyl group.	No verified direct reference in this release
`Os01g0940000`	Catalyzes the oxidation of cytokinins, a family of N(6)-substituted adenine derivatives that are plant hormones, where the substituent is an isopentenyl group.	No verified direct reference in this release
`Os05g0374200`	Catalyzes the oxidation of cytokinins, a family of N(6)-substituted adenine derivatives that are plant hormones, where the substituent is an isopentenyl group (Probable).	Strigolactone promotes cytokinin degradation through transcriptional activation of CYTOKININ OXIDASE/DEHYDROGENASE 9 in rice.2019 · DOI: 10.1073/pnas.1810980116

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028533 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009690 cytokinin metabolic process Biological Process

GO:0009823 cytokinin catabolic process Biological Process

GO:0048507 meristem development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0019139 cytokinin dehydrogenase activity Molecular Function

GO:0071949 FAD binding Molecular Function

KEGG gene cross-reference

ath:AT2G41510

ath:AT5G21482

dosa:Os01g0940000

dosa:Os05g0374200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.717

Rank 1 · TkA07G166140 · TK1151

Nucleus0.296

Rank 2 · TkA07G166140 · TK1151

Peroxisome0.104

Rank 3 · TkA07G166140 · TK1151

Mitochondrion0.080

Rank 4 · TkA07G166140 · TK1151

Plastid0.052

Rank 5 · TkA07G166140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01565FAD_binding_461-201 aa

PF01565FAD_binding_4211-243 aa

PF09265Cytokin-bind233-400 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G166140	`PF01565`	FAD_binding_4	61	201	2.7e-21	76.4
TkA07G166140	`PF01565`	FAD_binding_4	211	243	2.7e-21	76.4
TkA07G166140	`PF09265`	Cytokin-bind	233	400	4.7e-62	210.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FUJ1`	Arabidopsis thaliana	sp\|Q9FUJ1\|CKX7_ARATH Cytokinin dehydrogenase 7	61.800%	Swiss-Prot	High
`O22213`	Arabidopsis thaliana	sp\|O22213\|CKX1_ARATH Cytokinin dehydrogenase 1	46.800%	Swiss-Prot	Medium
`Q6Z955`	Oryza sativa subsp. japonica	sp\|Q6Z955\|CKX11_ORYSJ Cytokinin dehydrogenase 11	53.700%	Swiss-Prot	High
`Q5ZAY9`	Oryza sativa subsp. japonica	sp\|Q5ZAY9\|CKX5_ORYSJ Cytokinin dehydrogenase 5	50.500%	Swiss-Prot	High
`Q5JLP4`	Oryza sativa subsp. japonica	sp\|Q5JLP4\|CKX4_ORYSJ Cytokinin dehydrogenase 4	45.400%	Swiss-Prot	Medium
`Q75K78`	Oryza sativa subsp. japonica	sp\|Q75K78\|CKX9_ORYSJ Cytokinin dehydrogenase 9	47.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card