TkA07G163420 | RubberDandelionOmics

Gene overview

TkA07G163420

Reference: TK1151 Chr: Chr07 Coordinates: 42000979-42008820 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1641 bp · TkA07G163420|TK1151|cDNA

CTCCGTCCCCACTCTACTACCATCCACACCCTATCCTAGTCACTCACCCACCTGTATGATCCAACCATCTCTTCCTATAAGTAAGAGCTTTTAAGCAAAACCATGCTTTCATCTTCTAGTTCCATTTGCTTCTTCAATGGCTTCGCCTCTCCACCTTTTTTTCTTCATTTCCTTTCTTACCCTCAATTTTTCTGCTATTTCCCTTTTTGCCCTCAAAGTTCATGTTGGTGGAGACACTGGCCTCAGTTTGTCTAAAGCCT...

CDS

Download CDS FASTA

1383 bp · TkA07G163420|TK1151|CDS

ATGGCTTCGCCTCTCCACCTTTTTTTCTTCATTTCCTTTCTTACCCTCAATTTTTCTGCTATTTCCCTTTTTGCCCTCAAAGTTCATGTTGGTGGAGACACTGGCCTCAGTTTGTCTAAAGCCTGCAGCAATATATGCGAATCCTCCTTCTGCAAAGTGCCACCATTGCTGAGATACGGGAAGTATTGTGGGATACTATACAGTGGATGTCCAGGAGAGAAGCCTTGCGATGATCTTGATGCATGTTGTATGAAACATGA...

Protein

Download Protein FASTA

460 aa · TkA07G163420|TK1151|PROTEIN

MASPLHLFFFISFLTLNFSAISLFALKVHVGGDTGLSLSKACSNICESSFCKVPPLLRYGKYCGILYSGCPGEKPCDDLDACCMKHDSCIAAHNIKPMARLGIGSMESLNWALLLKWIWRFKNEKDYLWRRVVCGTHNLEKKPVNALCKISIPGVWQNITKTISAIENIGIRLSSFFGFQLGDGNDVRFWQDWWNGDECLADQFTDLFMLDKKKSASVAERLGDANGGLKWKKKPSSAVEIAQLDSLLGIIGNKQLSNSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G163420`
TK1151 ID	TkA07G163420
OH-1004 ID	LXL04_002094
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	76.600
Protein coverage (%)	TK1151 44.565 / OH-1004 84.711 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G163420

Location Chr07:42000979-42008820 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g06925`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`At4g29460`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`At2g19690`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0708000`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release
`Os03g0261100`	PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002094 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.290

Rank 1 · TkA07G163420 · TK1151

Cytoplasm0.285

Rank 2 · TkA07G163420 · TK1151

Nucleus0.263

Rank 3 · TkA07G163420 · TK1151

Endoplasmic reticulum0.128

Rank 4 · TkA07G163420 · TK1151

Golgi apparatus0.097

Rank 5 · TkA07G163420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00068Phospholip_A2_157-92 aa

PF13966zf-RVT289-357 aa

PF00068Phospholip_A2_1322-351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G163420	`PF00068`	Phospholip_A2_1	57	92	0.00026	22.2
TkA07G163420	`PF13966`	zf-RVT	289	357	1.3e-14	55.3
TkA07G163420	`PF00068`	Phospholip_A2_1	322	351	0.00026	22.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8N6`	Arabidopsis thaliana	sp\|Q8S8N6\|PLA2A_ARATH Phospholipase A2-alpha	51.300%	Swiss-Prot	High
`Q9M0D7`	Arabidopsis thaliana	sp\|Q9M0D7\|PLA2C_ARATH Phospholipase A2-gamma	41.900%	Swiss-Prot	Medium
`Q8GZB4`	Arabidopsis thaliana	sp\|Q8GZB4\|PLA2B_ARATH Phospholipase A2-beta	37.400%	Swiss-Prot	Medium
`Q10E50`	Oryza sativa subsp. japonica	sp\|Q10E50\|PLA23_ORYSJ Phospholipase A2 homolog 3	60.200%	Swiss-Prot	High
`Q9XG81`	Oryza sativa subsp. japonica	sp\|Q9XG81\|PLA22_ORYSJ Probable phospholipase A2 homolog 2	55.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card