TkA07G155970 | RubberDandelionOmics

Gene overview

TkA07G155970

Reference: TK1151 Chr: Chr07 Coordinates: 40067160-40068690 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1118 bp · TkA07G155970|TK1151|cDNA

TTCAAATTACGACTGTATAAAACCGTCGAACAACCAAAAATTCACATTTACGCGATCATTACTTTTGCCGTTGCCGAAACACATACAATGTCTAAACGACGGTTTCAATTACAGTTATACGGTTTTATCCCGCATATACGGACCGATTTGGAACTGCTTATAACCCAACGACATCGATATCTAACCAGTTCCATATCAAATTTATCTCATCTACAATGCTACTCACTGTTGCGTCTGTGGCATAATAAACAATTTCAGGA...

CDS

Download CDS FASTA

594 bp · TkA07G155970|TK1151|CDS

ATGACGAGGGAGATTTCAACAATATTGGAAGTTACTAGACAATTGCAGAAAAAATGGACAGTCCTTATTCAAGTAATTGACAAAGGGAACGTTCAAGTAAGTAAAACAGAAAAAAAGTACAGGAGGCTCATGTTCTGCGATAAAAAGGGGACTAGAGTTTCTGCAGTTATCTATGCAGATATTATTGAATTTTTTGAAAATACCTTCAAACAGTACAACCAATACTACATATCAAATGCCAAGCTACTGGATTTAGAAGC...

Protein

Download Protein FASTA

197 aa · TkA07G155970|TK1151|PROTEIN

MTREISTILEVTRQLQKKWTVLIQVIDKGNVQVSKTEKKYRRLMFCDKKGTRVSAVIYADIIEFFENTFKQYNQYYISNAKLLDLEARFIVGDYHYSWHLTKQTLVEPYLEDPLPPLSWILTLPHSANYINMPTEIYENIRGIVIKIFPSQVVKEAQETSKKTDASTKRYIVIINEEYVGHYYIYYDLFLSYKTLTF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G155970`
TK1151 ID	TkA07G155970
OH-1004 ID	LXL04_037528
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	73.600
Protein coverage (%)	TK1151 89.848 / OH-1004 7.896 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G155970`
Location	Chr07:40067160-40068690 (+)
Description	Similar to Pif1: ATP-dependent DNA helicase PIF1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037528` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0001117 protein-DNA-RNA complex disassembly Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0031297 replication fork processing Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0043504 mitochondrial DNA repair Biological Process GO:0071932 replication fork reversal Biological Process GO:1902983 DNA strand elongation involved in mitotic DNA replication Biological Process GO:1903469 removal of RNA primer involved in mitotic DNA replication Biological Process GO:1990426 mitotic recombination-dependent replication fork processing Biological Process
KEGG gene cross-reference	hsa:80119 mmu:208084 rno:367645 spo:2541213 xla:734585 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.785

Rank 1 · TkA07G155970 · TK1151

Cytoplasm0.257

Rank 2 · TkA07G155970 · TK1151

Mitochondrion0.029

Rank 3 · TkA07G155970 · TK1151

Extracellular0.029

Rank 4 · TkA07G155970 · TK1151

Cell membrane0.022

Rank 5 · TkA07G155970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22379OB_MCM1011-61 aa

PF02721DUF22317-108 aa

PF22379OB_MCM10138-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G155970	`PF22379`	OB_MCM10	11	61	0.025	15.1
TkA07G155970	`PF02721`	DUF223	17	108	2e-07	31.9
TkA07G155970	`PF22379`	OB_MCM10	138	159	0.025	15.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card