TkA07G154380 | RubberDandelionOmics

Gene overview

TkA07G154380

Reference: TK1151 Chr: Chr07 Coordinates: 39736672-39739076 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1907 bp · TkA07G154380|TK1151|cDNA

CGAAACCATAATTCTACATGCTTTGACAAAGACTGCCCACTACCTTTTTGTTTTTCTTGGAAAAAGAAAACATTTTTCATAAAAATATGCGAATCATTCTCTTTCGAAGTCTCATCAGCTCACGCTTTCTTCCATATCAATTCCCCCTTTTGTAGCAGCAACCACATCAAAACAACCCATAATTGTGTTCTTGGATAACTCCTTGAAGATCTGTGTATAATTTTCATAAGTTTGTGTAGTTTTCCTCTCGAATTCTGTAT...

CDS

Download CDS FASTA

1458 bp · TkA07G154380|TK1151|CDS

ATGTCACCGGCGGCCGTGGTTGACCCGACGACCCACACACTACAGGAATCTTCAGCTTCCACCGAGTCGTCACCGGAGAGAGGTGAATCGAACAATAATCGCCGTTTTTGGGACTTGAGAGGCGTTCAGTGGCGTACTGATTTGGGGGTTTTGCCTTCTTCTTCCTCTGTCGATGAAGTTCGTCGTGTTACTGCCAATTCCCGTAGAAGCTATGCTGCTTTAAGAAGGCGGCACCTGATCGACCCTCTTCCTAAAGAGGG...

Protein

Download Protein FASTA

485 aa · TkA07G154380|TK1151|PROTEIN

MSPAAVVDPTTHTLQESSASTESSPERGESNNNRRFWDLRGVQWRTDLGVLPSSSSVDEVRRVTANSRRSYAALRRRHLIDPLPKEGTSFPDLVMDNPLSQDPDSMWGRFFQKAEIEKMVDQDLSRLYPEHGSYFQTPGCQGVLRRILLLWCIRHPDHGYRQGMHELLAPLLYVLEADVERLSAVRKLYKHYFTDNFDGLSFHNTDSTYNQTSQNTENNNEIQEPLNTLDPKIQTIISFCDPYGAEGELGIVLSQKFMEH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G154380`
TK1151 ID	TkA07G154380
OH-1004 ID	LXL04_002982
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	64.900
Protein coverage (%)	TK1151 87.423 / OH-1004 60.966 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G154380`
Location	Chr07:39736672-39739076 (-)
Description	Similar to Tbc1d5: TBC1 domain family member 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002982` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002092 positive regulation of receptor internalization Biological Process GO:0006914 autophagy Biological Process GO:0007193 adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway Biological Process GO:0015031 protein transport Biological Process GO:0016236 macroautophagy Biological Process GO:0031000 response to caffeine Biological Process GO:0042147 retrograde transport, endosome to Golgi Biological Process GO:0042594 response to starvation Biological Process GO:1903665 negative regulation of asexual reproduction Biological Process GO:0005737 cytoplasm Cellular Component GO:0005776 autophagosome Cellular Component GO:0005794 Golgi apparatus Cellular Component
KEGG gene cross-reference	ddi:DDB_G0280253 ddi:DDB_G0281891 hsa:9779 mmu:72238 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.496

Rank 1 · TkA07G154380 · TK1151

Nucleus0.468

Rank 2 · TkA07G154380 · TK1151

Cell membrane0.090

Rank 3 · TkA07G154380 · TK1151

Lysosome / Vacuole0.074

Rank 4 · TkA07G154380 · TK1151

Golgi apparatus0.067

Rank 5 · TkA07G154380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00566RabGAP-TBC115-199 aa

PF23436RabGap-TBC_2156-190 aa

PF09573RE_TaqI177-229 aa

PF00566RabGAP-TBC253-355 aa

PF23436RabGap-TBC_2303-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G154380	`PF00566`	RabGAP-TBC	115	199	1.7e-28	100.5
TkA07G154380	`PF23436`	RabGap-TBC_2	156	190	0.00034	21.1
TkA07G154380	`PF09573`	RE_TaqI	177	229	0.069	13.2
TkA07G154380	`PF00566`	RabGAP-TBC	253	355	1.7e-28	100.5
TkA07G154380	`PF23436`	RabGap-TBC_2	303	354	0.00034	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card