TkA07G142390 | RubberDandelionOmics

Gene overview

TkA07G142390

Reference: TK1151 Chr: Chr07 Coordinates: 36740503-36742672 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1862 bp · TkA07G142390|TK1151|cDNA

TTTTGAACCCATACTCTCATGATAATAATGAAACCGCAAGTAATGAAAGAGGCTGCACTCACTTTTCTCATATTCTGCATTGGCTTACATTTAAAAGTCTTATGCTTTTTGCAACCAGATTCTAGTCCAGATGAAACCTACCTTGGATTGACATACGAAGCCACCGATTTCTCTCCAGCACAAGAATACGATTATATTATTGTAGGAGGAGGGACTGCCGGTTGCCCGTTAGCTGCCACTTTATCTGAAAAATATTCCGT...

CDS

Download CDS FASTA

1683 bp · TkA07G142390|TK1151|CDS

ATGATAATAATGAAACCGCAAGTAATGAAAGAGGCTGCACTCACTTTTCTCATATTCTGCATTGGCTTACATTTAAAAGTCTTATGCTTTTTGCAACCAGATTCTAGTCCAGATGAAACCTACCTTGGATTGACATACGAAGCCACCGATTTCTCTCCAGCACAAGAATACGATTATATTATTGTAGGAGGAGGGACTGCCGGTTGCCCGTTAGCTGCCACTTTATCTGAAAAATATTCCGTACTACTACTTGAGCGAGG...

Protein

Download Protein FASTA

560 aa · TkA07G142390|TK1151|PROTEIN

MIIMKPQVMKEAALTFLIFCIGLHLKVLCFLQPDSSPDETYLGLTYEATDFSPAQEYDYIIVGGGTAGCPLAATLSEKYSVLLLERGGVANLDPNVLYENNSLTTLLTANEKDSPAQNFISEDGVLNSRGRVLGGSSMINFGFYSRADDYFYQNSGIEWDKSDVERAYEWVEDSIVTRPDRLGKWQESTLNALLQSGVYPDNGFTLDHLQGTKISGSTFDDSGRRHGAVELLNKANPENLKVVVHATVDRVILSTSNPLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G142390`
TK1151 ID	TkA07G142390
OH-1004 ID	LXL04_028317
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 87.321 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G142390

Location Chr07:36740503-36742672 (-)

Description Similar to MDL2: (R)-mandelonitrile lyase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g73050`	(R)-mandelonitrile lyase-like.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028317 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0046202 cyanide biosynthetic process Biological Process

GO:0050898 nitrile metabolic process Biological Process

GO:0033095 aleurone grain Cellular Component

GO:0016614 oxidoreductase activity, acting on CH-OH group of donors Molecular Function

GO:0046593 mandelonitrile lyase activity Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

KEGG gene cross-reference

ath:AT1G73050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.383

Rank 1 · TkA07G142390 · TK1151

Endoplasmic reticulum0.218

Rank 2 · TkA07G142390 · TK1151

Cytoplasm0.167

Rank 3 · TkA07G142390 · TK1151

Extracellular0.167

Rank 4 · TkA07G142390 · TK1151

Cell membrane0.072

Rank 5 · TkA07G142390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00732GMC_oxred_N57-325 aa

PF07992Pyr_redox_257-114 aa

PF01266DAO58-89 aa

PF05834Lycopene_cycl58-87 aa

PF00890FAD_binding_258-91 aa

PF13738Pyr_redox_360-123 aa

PF13450NAD_binding_861-87 aa

PF05199GMC_oxred_C122-134 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G142390	`PF00732`	GMC_oxred_N	57	325	1e-20	75.2
TkA07G142390	`PF07992`	Pyr_redox_2	57	114	0.0049	17.0
TkA07G142390	`PF01266`	DAO	58	89	0.0021	18.4
TkA07G142390	`PF05834`	Lycopene_cycl	58	87	0.07	12.9
TkA07G142390	`PF00890`	FAD_binding_2	58	91	0.13	12.2
TkA07G142390	`PF13738`	Pyr_redox_3	60	123	0.067	13.1
TkA07G142390	`PF13450`	NAD_binding_8	61	87	0.0046	17.9
TkA07G142390	`PF05199`	GMC_oxred_C	122	134	3.5e-23	83.4
TkA07G142390	`PF00890`	FAD_binding_2	235	301	0.13	12.2
TkA07G142390	`PF10976`	DUF2790	248	285	0.18	12.6
TkA07G142390	`PF05199`	GMC_oxred_C	251	271	3.5e-23	83.4
TkA07G142390	`PF05199`	GMC_oxred_C	401	542	3.5e-23	83.4
TkA07G142390	`PF01266`	DAO	459	496	0.0021	18.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SSM2`	Arabidopsis thaliana	sp\|Q9SSM2\|MDLL_ARATH (R)-mandelonitrile lyase-like	51.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card