Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2936 bp · TkA07G113380|TK1151|cDNA
ATGTCTATTGATAAAAGTTGGATTACTCTTGAAAATCGTAACTCTCCCGAGTTTCAACAAGGACTTCTCTCCTTTGTTGAAATGTCCAAAGCACACGTCGATAACCAAGGTCTAATCAGATGCCCCTGTCGAATATGTGTAAACAATGATTTCAAAACAATTTTTCAAATGAAAGGTCATATTCATAGATTTGGGTTTGAACAACGTTATATTACTTGGGTCTATCACGGTGAACGTAATACTCCTCCGGTTGTGTATGA...
2172 bp · TkA07G113380|TK1151|CDS
ATGTCTATTGATAAAAGTTGGATTACTCTTGAAAATCGTAACTCTCCCGAGTTTCAACAAGGACTTCTCTCCTTTGTTGAAATGTCCAAAGCACACGTCGATAACCAAGGTCTAATCAGATGCCCCTGTCGAATATGTGTAAACAATGATTTCAAAACAATTTTTCAAATGAAAGGTCATATTCATAGATTTGGGTTTGAACAACGTTATATTACTTGGGTCTATCACGGTGAACGTAATACTCCTCCGGTTGTGTATGA...
Protein
Download Protein FASTA723 aa · TkA07G113380|TK1151|PROTEIN
MSIDKSWITLENRNSPEFQQGLLSFVEMSKAHVDNQGLIRCPCRICVNNDFKTIFQMKGHIHRFGFEQRYITWVYHGERNTPPVVYDVNPSCEMADVIEDVRGESRENDTNHTQGGLDAECSNADDEFSSLLEEARSELYPGCTQLTSLDFIAKLMHFKAISKWTDTSCNLLLDFLKFAFPEGNKVPSSYYEAKKILKKIGLGYEPSEKKGKGKEPSAHPYMVGDIHDLLIREMGIIISRDIPLNKDGWRKVPAEEKNAL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G113380 |
|---|---|
| TK1151 ID | TkA07G113380 |
| OH-1004 ID | LXL04_028019 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 95.100 |
| Protein coverage (%) | TK1151 94.744 / OH-1004 99.583Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G113380 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:29423831-29430439 (+) | |||||||||
| Description | Similar to AUR1: Serine/threonine-protein kinase Aurora-1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0000278 mitotic cell cycle Biological Process GO:0000281 mitotic cytokinesis Biological Process GO:0001934 positive regulation of protein phosphorylation Biological Process GO:0007051 spindle organization Biological Process GO:0007052 mitotic spindle organization Biological Process GO:0031117 positive regulation of microtubule depolymerization Biological Process GO:0032206 positive regulation of telomere maintenance Biological Process GO:0032465 regulation of cytokinesis Biological Process GO:0032466 negative regulation of cytokinesis Biological Process GO:0032467 positive regulation of cytokinesis Biological Process GO:0034501 protein localization to kinetochore Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G25880 ath:AT4G32830 mmu:20877 rno:114592 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13963Transpos_assoc5-78 aaPF14178YppF157-201 aaPF03004Transposase_24327-450 aaPF03004Transposase_24481-506 aaPF00069Pkinase649-695 aaPF07714PK_Tyr_Ser-Thr649-696 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G113380 | PF13963 | Transpos_assoc | 5 | 78 | 5.1e-17 | 62.5 |
| TkA07G113380 | PF14178 | YppF | 157 | 201 | 0.012 | 16.2 |
| TkA07G113380 | PF03004 | Transposase_24 | 327 | 450 | 1.2e-14 | 55.4 |
| TkA07G113380 | PF03004 | Transposase_24 | 481 | 506 | 1.2e-14 | 55.4 |
| TkA07G113380 | PF00069 | Pkinase | 649 | 695 | 5.2e-08 | 33.3 |
| TkA07G113380 | PF07714 | PK_Tyr_Ser-Thr | 649 | 696 | 1.3e-06 | 28.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.