TkA07G111980 | RubberDandelionOmics

Gene overview

TkA07G111980

Reference: TK1151 Chr: Chr07 Coordinates: 29018389-29025505 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2173 bp · TkA07G111980|TK1151|cDNA

AGACCGTCAATAATTCCAGCCTCGTATTTTTTAGACTTTTCCTTACTCCCATGTACCCGCCCGCATCCGATCTTTTCTACCCTTTTTCTAATCTCCCCTTTCTCGGTCGACAATACAAAGGCACGCTAAATTCTCTCTCTCTCTCTCTCTCTCTCTAGCTGTACAACTAAAAGATCTGTAAAATCTCTCCCAAAATCTCTCTCGGAATCATAAGTTTTGAGTTAGGGTTGGGCAAATGGCTAGTCGGTTGAAGGAGGATG...

CDS

Download CDS FASTA

1812 bp · TkA07G111980|TK1151|CDS

ATGGCTAGTCGGTTGAAGGAGGATGAGAGAAATGAGAGAACTATAAGGAATCTTTTGAAGCTTCCTGAGAATCGGAGGTGTATTAACTGCAATAGTTTGGGACCTCAATATGTGTGCACAAGCTTCTGGACATTTGTTTGCACAACTTGCAGTGGCATACACCGCGAGTTCACTCACAGGGTAAAATCAGTGTCAATGGCCAAGTTTACAACCCAAGAAGTTAGTGCCCTTCAAGGAGGAGGAAATGCGAGTGCAAAAGA...

Protein

Download Protein FASTA

603 aa · TkA07G111980|TK1151|PROTEIN

MASRLKEDERNERTIRNLLKLPENRRCINCNSLGPQYVCTSFWTFVCTTCSGIHREFTHRVKSVSMAKFTTQEVSALQGGGNASAKEIYLKEWDTQRQSLPDSSNVERLRDFIKHVYVDRRYSGERSFDKPPRSKTGETEDTYGSRSPPYETDRRYTDRPSPGGRSDTSSRNSYDERRSPEYNNQDLKKTSPARTDIVNDWRREDRFAKNPESVRSPDHHQQQQNISISSPPPVVRPVREILGESVSPLRVIEPPPLRSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G111980`
TK1151 ID	TkA07G111980
OH-1004 ID	LXL04_028006
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.700
Protein coverage (%)	TK1151 100.000 / OH-1004 93.769 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G111980

Location Chr07:29018389-29025505 (-)

Description Similar to AGD14: Probable ADP-ribosylation factor GTPase-activating protein AGD14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8RXE7`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028006 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001675 acrosome assembly Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0007289 spermatid nucleus differentiation Biological Process

GO:0045109 intermediate filament organization Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

GO:0042995 cell projection Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G08680

bta:536149

hsa:3267

mmu:15463

rno:363266

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.522

Rank 1 · TkA07G111980 · TK1151

Cell membrane0.227

Rank 2 · TkA07G111980 · TK1151

Golgi apparatus0.225

Rank 3 · TkA07G111980 · TK1151

Nucleus0.190

Rank 4 · TkA07G111980 · TK1151

Endoplasmic reticulum0.085

Rank 5 · TkA07G111980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412ArfGap13-123 aa

PF00643zf-B_box23-64 aa

PF04723GRDA31-89 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G111980	`PF01412`	ArfGap	13	123	9.8e-29	100.5
TkA07G111980	`PF00643`	zf-B_box	23	64	0.014	16.3
TkA07G111980	`PF04723`	GRDA	31	89	0.16	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXE7`	Arabidopsis thaliana	sp\|Q8RXE7\|AGD14_ARATH Probable ADP-ribosylation factor GTPase-activating protein AGD14	71.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card