TkA07G106430 | RubberDandelionOmics

Gene overview

TkA07G106430

Reference: TK1151 Chr: Chr07 Coordinates: 27618242-27623965 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1577 bp · TkA07G106430|TK1151|cDNA

TTAAAGCCTTAATTCCCTCTCGTTATCATATTACCCTTTTACCCCCACCCCCTTCTCCTTACAAGAAACACAATCTAGTTCAACATCACCAATACAACAAACCAAAAATCGAAACCCACGATTTTAATCAAAATGACTTGTTGTGGAACCAAGAAACCAAAAACGCTATCTCCTCCTCGAACGGCACCGCCACGAATGCCACCACCAACAACCAACAACCACCACCCGCAACCACAAACTGCCAAACACACAACCCTCCT...

CDS

Download CDS FASTA

1122 bp · TkA07G106430|TK1151|CDS

ATGACTTGTTGTGGAACCAAGAAACCAAAAACGCTATCTCCTCCTCGAACGGCACCGCCACGAATGCCACCACCAACAACCAACAACCACCACCCGCAACCACAAACTGCCAAACACACAACCCTCCTATCAGTTCCAAATTCCAAAGTTCATATAATGGACGAAGGTGAAGCAGTTGAGCTCGCAAATGGAAACTTTACGATAATTCAAATATCCGATGACAACATTCTACTAGCAACCATTATTAAAATCGGTGATGA...

Protein

Download Protein FASTA

373 aa · TkA07G106430|TK1151|PROTEIN

MTCCGTKKPKTLSPPRTAPPRMPPPTTNNHHPQPQTAKHTTLLSVPNSKVHIMDEGEAVELANGNFTIIQISDDNILLATIIKIGDDLQWPLTKDEPVVKLDLHHYLFTLPVIKGEDPLSYGVTFPKTDNDNLTLLDNFLKEHSCFSTSSVSRKTDIDWKEFAPKIDAYNNVLAKAIAGGTGQIVRGIFMCSNAYTNQLQKGGDMILKEAMEEKNGMSRTNTKESNKNNGTKKGDGINKSLRSARKLSKMTESMSKALLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G106430`
TK1151 ID	TkA07G106430
OH-1004 ID	LXL04_027929
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G106430

Location Chr07:27618242-27623965 (+)

Description Similar to P85: Senescence/dehydration-associated protein At4g35985, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35985`	Senescence/dehydration-associated protein At4g35985, chloroplastic.	No verified direct reference in this release
`At3g51250`	Senescence/dehydration-associated protein At3g51250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027929 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002239 response to oomycetes Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G17840

ath:AT3G51250

ath:AT4G35985

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.419

Rank 1 · TkA07G106430 · TK1151

Cytoplasm0.330

Rank 2 · TkA07G106430 · TK1151

Nucleus0.198

Rank 3 · TkA07G106430 · TK1151

Mitochondrion0.101

Rank 4 · TkA07G106430 · TK1151

Endoplasmic reticulum0.076

Rank 5 · TkA07G106430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06911Senescence175-371 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G106430	`PF06911`	Senescence	175	371	1.6e-37	129.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JNX2`	Arabidopsis thaliana	sp\|F4JNX2\|SDEH4_ARATH Senescence/dehydration-associated protein At4g35985, chloroplastic	31.200%	Swiss-Prot	Medium
`Q9SD22`	Arabidopsis thaliana	sp\|Q9SD22\|SDEH3_ARATH Senescence/dehydration-associated protein At3g51250	30.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card