Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2989 bp · TkA07G097900|TK1151|cDNA
TTTTTATAAGTCGATATCAAAAAGTGATTTTACTATCTGATTCTGAACTGCGAATTGACATTTATACAATTATAGACCTAGTACCCTCAAAACTTACGCCTCCACAAAACGCACAACCCATTCACGTCGCCGTCTGTGCCTGCTGCCGCCCTCCGTCGATCAGAGCCACCGGCGGCCACCTCCCCCACTACAGACGCCGCAATCCAGCTCGTAGGTCTCGCTTCATCTTCGATTGAGCCCCTGGTACAGTCTTAATCTGC...
2397 bp · TkA07G097900|TK1151|CDS
ATGGGGGATATTTCTAGCAGCGGTGCTGGAGATGAACAGAGAGCGGTGAAGCTTCCAATTGCCGGCAAAAGAAACATCCTCATCACCAGTGCTCTCCCTTATGTCAACAACGTTCCACACCTTGGAAACATCATTGGATGTGTATTGAGTGCTGATGTGTTTGCTCGATACTGTCGACTGAGGGGATACAATGCGATATACATATGTGGCACTGATGAATACGGAACAGCTACCGAGACCAAAGCCTTGGAAGAAAATTC...
Protein
Download Protein FASTA798 aa · TkA07G097900|TK1151|PROTEIN
MGDISSSGAGDEQRAVKLPIAGKRNILITSALPYVNNVPHLGNIIGCVLSADVFARYCRLRGYNAIYICGTDEYGTATETKALEENSTPKEICDKYHAIHRDVYKWFNISFDEFGRTSSPQQTEVCQAIFKKLLDNNWLSENTMQQLYCDTCNKFLADRLVEGSCPTPGCNYDSARGDQCENCGKLLNPTELIKPRCKVCKSSPRIRDTDHLFLELPLLEGKLRDYISAMSVAGSWSQNAIHATNAWLKEGLRQRCITRD...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G097900 |
|---|---|
| TK1151 ID | TkA07G097900 |
| OH-1004 ID | LXL04_008351 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 90.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G097900 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:25551947-25565196 (-) | ||||||||||||
| Description | Similar to Os06g0508700: Probable methionine--tRNA ligase | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006431 methionyl-tRNA aminoacylation Biological Process GO:0009303 rRNA transcription Biological Process GO:0009791 post-embryonic development Biological Process GO:0036120 cellular response to platelet-derived growth factor stimulus Biological Process GO:0048608 reproductive structure development Biological Process GO:0071364 cellular response to epidermal growth factor stimulus Biological Process GO:1901838 positive regulation of transcription of nucleolar large rRNA by RNA polymerase I Biological Process GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005829 cytosol Cellular Component GO:0017101 aminoacyl-tRNA synthetase multienzyme complex Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT4G13780 ddi:DDB_G0279113 mmu:216443 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF09334tRNA-synt_1g26-420 aaPF00133tRNA-synt_127-269 aaPF01406tRNA-synt_1e33-143 aaPF20097DUF6487131-158 aaPF00130C1_1137-156 aaPF00130C1_1177-201 aaPF20097DUF6487179-187 aaPF24685OB_RRP5_4th206-234 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G097900 | PF09334 | tRNA-synt_1g | 26 | 420 | 7.1e-154 | 513.0 |
| TkA07G097900 | PF00133 | tRNA-synt_1 | 27 | 269 | 7.6e-11 | 42.1 |
| TkA07G097900 | PF01406 | tRNA-synt_1e | 33 | 143 | 0.014 | 15.5 |
| TkA07G097900 | PF20097 | DUF6487 | 131 | 158 | 0.13 | 13.4 |
| TkA07G097900 | PF00130 | C1_1 | 137 | 156 | 4.8 | 7.8 |
| TkA07G097900 | PF00130 | C1_1 | 177 | 201 | 4.8 | 7.8 |
| TkA07G097900 | PF20097 | DUF6487 | 179 | 187 | 0.13 | 13.4 |
| TkA07G097900 | PF24685 | OB_RRP5_4th | 206 | 234 | 0.14 | 13.0 |
| TkA07G097900 | PF19303 | Anticodon_3 | 447 | 594 | 4.5e-18 | 66.3 |
| TkA07G097900 | PF08264 | Anticodon_1 | 456 | 541 | 0.21 | 12.2 |
| TkA07G097900 | PF00133 | tRNA-synt_1 | 569 | 613 | 7.6e-11 | 42.1 |
| TkA07G097900 | PF24685 | OB_RRP5_4th | 636 | 672 | 0.14 | 13.0 |
| TkA07G097900 | PF01588 | tRNA_bind | 644 | 736 | 8.7e-32 | 109.8 |
| TkA07G097900 | PF00130 | C1_1 | 690 | 700 | 4.8 | 7.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.