Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2977 bp · TkA07G094560|TK1151|cDNA
GTCTCTTTGGTGGAGAAACATTCCTAGTGAGAGCCGAAGGGCCAAAGCCCAAAGCTCCAACCTGAAATAAGCCCGATATCGGAAGCAACGACCATGGATTTGGCGGGAATGCAATCTTGCCCTACAAGCTCTCCATATCCCTCGATTTAAACACCTAAAGGCTTAAACCCTTACCGGCTGTTTTCATCTTCGTCTTAACATGATCAGACGGTTTTCTTCAGTCAAGTAAGTACAGAATCTCCATCTTGAATTCTTCGCCC...
2436 bp · TkA07G094560|TK1151|CDS
ATGCCGGTTCTAAGGTCAAGAAAAGTTGATTCTGTAACTCAGAACGAACAATCGCATAAACCCCTTATAAATGGGGATCAAATCGAACCACCAACACCGGCAAAGGAAGTCGAGTCAACGACAAAACCGTCACATGAAAGGACCCCGAGTCCATACAACTTGGTTCACAGTTCCGATAAGACAGGGTCAGTCGGTAGTATAGACTCCGAGTCTGTTTCGAACATACCTCTGAGAAGGAGTGCACGACTTTCCTCGAAGTC...
Protein
Download Protein FASTA811 aa · TkA07G094560|TK1151|PROTEIN
MPVLRSRKVDSVTQNEQSHKPLINGDQIEPPTPAKEVESTTKPSHERTPSPYNLVHSSDKTGSVGSIDSESVSNIPLRRSARLSSKSSSYNVVENVGSRRKRKNVNSSVQVSASGIEKESGGSKDDVIDVRDSNGYDREDTLNVQKVKNQRLLSHDICFLSSESVQECDLGNKTLSLRSGKKLLKPEIENVAIEQELSPYQKDEKETEEGNSDTVVHEATQVTESLTFEAEEGSSGTKNDGEKTRKRFSTEDKQKGVMVD...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G094560 |
|---|---|
| TK1151 ID | TkA07G094560 |
| OH-1004 ID | LXL04_027799 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G094560 |
|---|---|
| Location | Chr07:24662681-24666060 (-) |
| Description | Similar to rhp7: DNA repair protein rhp7 (Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0003341 cilium movement Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0010311 lateral root formation Biological Process GO:0010824 regulation of centrosome duplication Biological Process GO:0016567 protein ubiquitination Biological Process GO:0030317 flagellated sperm motility Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0051781 positive regulation of cell division Biological Process GO:0071365 cellular response to auxin stimulus Biological Process GO:0000113 nucleotide-excision repair factor 4 complex Cellular Component GO:0005634 nucleus Cellular Component |
| KEGG gene cross-reference | ath:AT1G21410 ath:AT3G58530 hsa:222235 spo:2539094 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12799LRR_4412-419 aaPF25372LRR_FBXL15457-579 aaPF09235SAM_Ste50p467-486 aaPF29594LRR_SKP2486-568 aaPF24048LRR_NXF1-5520-560 aaPF12799LRR_4522-558 aaPF27094DUF8346523-568 aaPF13516LRR_6532-539 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G094560 | PF12799 | LRR_4 | 412 | 419 | 0.0034 | 18.3 |
| TkA07G094560 | PF25372 | LRR_FBXL15 | 457 | 579 | 8.6e-13 | 48.2 |
| TkA07G094560 | PF09235 | SAM_Ste50p | 467 | 486 | 0.0029 | 18.5 |
| TkA07G094560 | PF29594 | LRR_SKP2 | 486 | 568 | 6.7e-10 | 39.4 |
| TkA07G094560 | PF24048 | LRR_NXF1-5 | 520 | 560 | 0.012 | 15.9 |
| TkA07G094560 | PF12799 | LRR_4 | 522 | 558 | 0.0034 | 18.3 |
| TkA07G094560 | PF27094 | DUF8346 | 523 | 568 | 0.024 | 13.9 |
| TkA07G094560 | PF13516 | LRR_6 | 532 | 539 | 0.00017 | 22.1 |
| TkA07G094560 | PF13516 | LRR_6 | 549 | 568 | 0.00017 | 22.1 |
| TkA07G094560 | PF23952 | LRR_EndoS | 549 | 612 | 3.1 | 8.8 |
| TkA07G094560 | PF09235 | SAM_Ste50p | 573 | 587 | 0.0029 | 18.5 |
| TkA07G094560 | PF29594 | LRR_SKP2 | 576 | 675 | 6.7e-10 | 39.4 |
| TkA07G094560 | PF12799 | LRR_4 | 591 | 616 | 0.0034 | 18.3 |
| TkA07G094560 | PF13516 | LRR_6 | 599 | 615 | 0.00017 | 22.1 |
| TkA07G094560 | PF27094 | DUF8346 | 608 | 675 | 0.024 | 13.9 |
| TkA07G094560 | PF25372 | LRR_FBXL15 | 622 | 670 | 8.6e-13 | 48.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.