TkA07G094540 | RubberDandelionOmics

Gene overview

TkA07G094540

Reference: TK1151 Chr: Chr07 Coordinates: 24657919-24660534 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2125 bp · TkA07G094540|TK1151|cDNA

TCTCAACCCATTTCCCTTCACATCCTCTTTTCCCTGGCCACCCCTCTTCCAACAAACCAAAATGTCAAAATTACCCCCACAACCACAAAATAACTACGTTTCTCGTTTTTCAGTTACCCAGATGGCAATTTCGTAATTATTCAAAAAACCAACACTCTTTCAAGAATCCACAAGATAGTCTCTTTTTTCTCGCAGAATACATACACTTCATTACATCTAAGTTAAAAAGGATTCTTAAACACCAAGGTCAATGCTTCACC...

CDS

Download CDS FASTA

864 bp · TkA07G094540|TK1151|CDS

ATGACGACAATCGGAATCCAGAAACCTCGTTTCGCGATTCCCCCTTGCTATGGACCCCGGAATCATCAATTCCATTCCACCCCATCAATCATAACAATGACAATGAATTCAGAATCTTCACATGGCATAAAAAAACAAGATTTATCAATAAAGATTCAAGAAAACTATATTTGTAAATCAGAAACCACACATCTTCAATTTAATCGACTGCAACAAGAACATGATGAATTATTTGGTCAGGACAAGAAACATGAATTCGG...

Protein

Download Protein FASTA

287 aa · TkA07G094540|TK1151|PROTEIN

MTTIGIQKPRFAIPPCYGPRNHQFHSTPSIITMTMNSESSHGIKKQDLSIKIQENYICKSETTHLQFNRLQQEHDELFGQDKKHEFGQFVARRAVLDEEYWTAAWLRAETHLEDRKDDRFVDSYRRKFTEQEFNALKRQSKTKHGQKSACIVTVKKEKESDRQTVLKSVVGTLDVSIRPFLQGETFPGEIVKAPIFFNTERTDPKKQYGYISNLCVAMSARRQGIARNMLHFAIESAMSDGVEQVYVHVHRKNIAAQELY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G094540`
TK1151 ID	TkA07G094540
OH-1004 ID	LXL04_027797
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G094540

Location Chr07:24657919-24660534 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g06025`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a large spectrum of modified N-termini, including methionine, alanine, serine, threonine and to a lower extent valine as substrates, and epsilon-lysine acetylation (KA).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027797 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0004596 protein-N-terminal amino-acid acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G06025

ath:AT4G28030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.790

Rank 1 · TkA07G094540 · TK1151

Cytoplasm0.125

Rank 2 · TkA07G094540 · TK1151

Nucleus0.113

Rank 3 · TkA07G094540 · TK1151

Mitochondrion0.073

Rank 4 · TkA07G094540 · TK1151

Cell membrane0.047

Rank 5 · TkA07G094540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13302Acetyltransf_3118-118 aa

PF00583Acetyltransf_1146-265 aa

PF24553Rv0428c_C199-266 aa

PF13420Acetyltransf_4205-268 aa

PF13673Acetyltransf_10206-268 aa

PF08445FR47206-267 aa

PF13508Acetyltransf_7208-266 aa

PF13527Acetyltransf_9208-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G094540	`PF13302`	Acetyltransf_3	118	118	0.00069	21.1
TkA07G094540	`PF00583`	Acetyltransf_1	146	265	3.8e-13	50.4
TkA07G094540	`PF24553`	Rv0428c_C	199	266	0.0021	18.5
TkA07G094540	`PF13420`	Acetyltransf_4	205	268	0.0012	19.6
TkA07G094540	`PF13673`	Acetyltransf_10	206	268	1.7e-09	38.5
TkA07G094540	`PF08445`	FR47	206	267	6.8e-08	33.1
TkA07G094540	`PF13508`	Acetyltransf_7	208	266	4.9e-09	37.2
TkA07G094540	`PF13527`	Acetyltransf_9	208	267	0.028	15.1
TkA07G094540	`PF13880`	Acetyltransf_13	211	239	0.022	15.3
TkA07G094540	`PF13302`	Acetyltransf_3	216	266	0.00069	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUT5`	Arabidopsis thaliana	sp\|Q8GUT5\|GNAT6_ARATH GCN5-related N-acetyltransferase 6, chloroplastic	56.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card