RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G093540
Reference: TK1151 Chr: Chr07 Coordinates: 24375137-24380038 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3163 bp · TkA07G093540|TK1151|cDNA

TTCACAATCAAGTCTCATTAAGATTTAGAAAAAGAATGTTCAAAAGAGCGCTTAAATCACGGATTGTACCACCACCATGACACGCACCTTCATTCAAAAATGTATGAAAGAGGGAATAGCCGTTGCAATTCATATTTTTATTTTTAATATTATTTAATACATGCAAAACCGAAAACAAACCCAAATCGAACTCACTCCAATTCTCAACTTAGCAACAATTCCCAAATTACATCCAATCGGAACACAATCTGATTCTTGAT...

CDS

Download CDS FASTA

2745 bp · TkA07G093540|TK1151|CDS

ATGGTTCACAAGATGAGCGTCAGTGCGCCTGTGACACCAGCAACCAAGATCCGAAGGACCCCTTCTTCAACTCCAAGTCATCCAAGAATCGCGGAGGAGAAAATCCTGGTCACCGTTAGGATCCGGCCATTAACGCATAGAGAGCTCGCTGCCTATGATCTTATTGCTTGGGATTGCACCGATGAGAACACTGTTGTTTCTAGAAACCTCAATCACGAGCGCCATAACGGAACTTACACTTTCGATAAAGTCTTCGATCC...

Protein

Download Protein FASTA

914 aa · TkA07G093540|TK1151|PROTEIN

MVHKMSVSAPVTPATKIRRTPSSTPSHPRIAEEKILVTVRIRPLTHRELAAYDLIAWDCTDENTVVSRNLNHERHNGTYTFDKVFDPSCPTRKIYEQGARDVALSAIKGINATIFAYGQTSSGKTYTMRGIAENVIEDIYDHIKNAVESKFVLKLSALEIYNETVIDLLNRDSGALRLLDDPEKGTVVEKLTEEVIKDSQHLRCLIATCEAQRQVGETSLNDRSSRSHQIIRLTIESSHREESGCVKSLLASLSLVDLAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G093540
TK1151 IDTkA07G093540
OH-1004 IDLXL04_027778
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)94.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G093540
LocationChr07:24375137-24380038 (-)
DescriptionSimilar to NACK2: Kinesin-like protein NACK2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g43210 Probable plus end-directed motor protein that functions in the NACK-PQR (ANP3-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion.
The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis.2004 · DOI: 10.1111/j.1365-2443.2004.00798.x
Arabidopsis kinesins HINKEL and TETRASPORE act redundantly to control cell plate expansion during cytokinesis in the male gametophyte.2008 · DOI: 10.1093/mp/ssn042
HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana.2010 · DOI: 10.1093/pcp/pcq135
AtMPK4 is required for male-specific meiotic cytokinesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04642.x
At1g18370 Probable plus end-directed motor protein that functions in the NACK-PQR (ANP1-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion.
Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex.2002 · DOI: 10.1016/s0092-8674(02)00691-8
The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis.2004 · DOI: 10.1111/j.1365-2443.2004.00798.x
Arabidopsis kinesins HINKEL and TETRASPORE act redundantly to control cell plate expansion during cytokinesis in the male gametophyte.2008 · DOI: 10.1093/mp/ssn042
HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana.2010 · DOI: 10.1093/pcp/pcq135
Phosphorylation of a mitotic kinesin-like protein and a MAPKKK by cyclin-dependent kinases (CDKs) is involved in the transition to cytokinesis in plants.2011 · DOI: 10.1073/pnas.1110174108

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0513900 May be essential to promote the progression of cytokinesis during node-internode differentiation.
The rice mutant dwarf bamboo shoot 1: a leaky mutant of the NACK-type kinesin-like gene can initiate organ primordia but not organ development.2005 · DOI: 10.1093/pcp/pci206
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027778 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000911 cytokinesis by cell plate formation Biological Process
GO:0000919 cell plate assembly Biological Process
GO:0007018 microtubule-based movement Biological Process
GO:0007112 male meiosis cytokinesis Biological Process
GO:0009555 pollen development Biological Process
GO:0009558 embryo sac cellularization Biological Process
GO:0010245 radial microtubular system formation Biological Process
GO:0048229 gametophyte development Biological Process
GO:0051301 cell division Biological Process
GO:0005634 nucleus Cellular Component
GO:0005874 microtubule Cellular Component
GO:0009506 plasmodesma Cellular Component
KEGG gene cross-reference
ath:AT1G18370
ath:AT3G43210
dosa:Os01g0513900
nta:107775653
nta:107780313
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.650
Rank 1 · TkA07G093540 · TK1151
Nucleus0.306
Rank 2 · TkA07G093540 · TK1151
Cell membrane0.091
Rank 3 · TkA07G093540 · TK1151
Mitochondrion0.058
Rank 4 · TkA07G093540 · TK1151
Golgi apparatus0.057
Rank 5 · TkA07G093540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd35-169 aa
PF00225Kinesin40-353 aa
PF01637ATPase_2108-143 aa
PF18440GlcNAc-1_reg141-170 aa
PF18440GlcNAc-1_reg347-368 aa
PF18052Rx_N360-384 aa
PF28743IPGAL2_N365-383 aa
PF11995DUF3490366-430 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G093540PF16796Microtub_bd351697.8e-2175.3
TkA07G093540PF00225Kinesin403531.2e-100337.4
TkA07G093540PF01637ATPase_21081430.1312.8
TkA07G093540PF18440GlcNAc-1_reg1411706.97.9
TkA07G093540PF18440GlcNAc-1_reg3473686.97.9
TkA07G093540PF18052Rx_N3603843.28.6
TkA07G093540PF28743IPGAL2_N3653830.02714.9
TkA07G093540PF11995DUF34903664305e-66222.2
TkA07G093540PF28743IPGAL2_N3894240.02714.9
TkA07G093540PF18052Rx_N3924353.28.6
TkA07G093540PF16796Microtub_bd4284847.8e-2175.3
TkA07G093540PF01637ATPase_24985420.1312.8
TkA07G093540PF11995DUF34905135495e-66222.2
TkA07G093540PF18440GlcNAc-1_reg5515906.97.9
TkA07G093540PF18052Rx_N5615923.28.6
TkA07G093540PF28743IPGAL2_N5685930.02714.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8LNZ2Arabidopsis thalianasp|Q8LNZ2|KN7B_ARATH Kinesin-like protein KIN-7B59.000%Swiss-ProtHigh
Q8S905Arabidopsis thalianasp|Q8S905|KN7A_ARATH Kinesin-like protein KIN-7A55.800%Swiss-ProtHigh
Q9AWM8Oryza sativa subsp. japonicasp|Q9AWM8|KN7A_ORYSJ Kinesin-like protein KIN-7A55.400%Swiss-ProtHigh

JBrowse

View in Genome Browser