TkA07G093350 | RubberDandelionOmics

Gene overview

TkA07G093350

Reference: TK1151 Chr: Chr07 Coordinates: 24313921-24315033 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · TkA07G093350|TK1151|cDNA

ATGGGATTCACAATGGGTTTGAATCTACTCCTTCTGGTAGCCATGGTTGCCACTAATATCCTCTCCCTCTACCACCTCTCCACCACCATGATCTCCACTAAACCGGCTACAAGTCCGAACACTCCTGTTCCAGACCACCTTCTCCGCCAACTTCAGACCATACGCGCCACCATTAACCACCTCACGCGCCTCCAACCTAACCCTTCCGTTCAGACCACCGCCTCCAACATCCCATCTGACCTCCTGCTGTACACTCAGCT...

CDS

Download CDS FASTA

1113 bp · TkA07G093350|TK1151|CDS

ATGGGATTCACAATGGGTTTGAATCTACTCCTTCTGGTAGCCATGGTTGCCACTAATATCCTCTCCCTCTACCACCTCTCCACCACCATGATCTCCACTAAACCGGCTACAAGTCCGAACACTCCTGTTCCAGACCACCTTCTCCGCCAACTTCAGACCATACGCGCCACCATTAACCACCTCACGCGCCTCCAACCTAACCCTTCCGTTCAGACCACCGCCTCCAACATCCCATCTGACCTCCTGCTGTACACTCAGCT...

Protein

Download Protein FASTA

370 aa · TkA07G093350|TK1151|PROTEIN

MGFTMGLNLLLLVAMVATNILSLYHLSTTMISTKPATSPNTPVPDHLLRQLQTIRATINHLTRLQPNPSVQTTASNIPSDLLLYTQLSPIASACRHHPDLLHQYMNYTPFSVCPALSSAAAEPLIMRGCHPLPRRRCFSRTPSKLPTSLPTNPFSPVPENAILWSNYKCKTFDCLNPDLGFDLRKEKSKFLSYKTDLDLPISQLTEIAKKSKNVLRLALDIGGGTGTFAAQMKQENVTVITTTMSLGAPYNEAAALRGLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G093350`
TK1151 ID	TkA07G093350
OH-1004 ID	LXL04_027772
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G093350

Location Chr07:24313921-24315033 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29790`	Probable methyltransferase At1g29790.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027772 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0032259 methylation Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0008168 methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G29790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.470

Rank 1 · TkA07G093350 · TK1151

Extracellular0.180

Rank 2 · TkA07G093350 · TK1151

Endoplasmic reticulum0.105

Rank 3 · TkA07G093350 · TK1151

Cell membrane0.089

Rank 4 · TkA07G093350 · TK1151

Nucleus0.044

Rank 5 · TkA07G093350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03141Methyltransf_29201-312 aa

PF13489Methyltransf_23218-241 aa

PF08241Methyltransf_11219-314 aa

PF13649Methyltransf_25219-310 aa

PF08242Methyltransf_12219-312 aa

PF05148Methyltransf_8268-344 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G093350	`PF03141`	Methyltransf_29	201	312	2.3e-08	33.8
TkA07G093350	`PF13489`	Methyltransf_23	218	241	0.15	12.4
TkA07G093350	`PF08241`	Methyltransf_11	219	314	0.00024	22.4
TkA07G093350	`PF13649`	Methyltransf_25	219	310	0.011	17.1
TkA07G093350	`PF08242`	Methyltransf_12	219	312	0.22	13.0
TkA07G093350	`PF05148`	Methyltransf_8	268	344	0.013	16.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWB7`	Arabidopsis thaliana	sp\|Q8RWB7\|PMT12_ARATH Probable methyltransferase At1g29790	63.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card