TkA07G085430 | RubberDandelionOmics

Gene overview

TkA07G085430

Reference: TK1151 Chr: Chr07 Coordinates: 22325695-22330665 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2182 bp · TkA07G085430|TK1151|cDNA

CAAAGCTGAAGAGCCCAAATGTAAGTTTTAACCGATTTATGTTTAAAGGCTGCTGTCTGTCTCTCGTCCTCAGTCTGACGACTCTCCTTATCCTCATTCCACAAAATCTCATCTCTCACTTTCGTCTTCTTCATTCACTCTTTATCACCTCCTATACTCCTATTTCCACTATCTAAACCGAAAATTATTCCTCAAATGTATGCTTAGAATCCGAGTTTCATGTATAGGATCATTACATGTTTGCATCTATACCGCCCGTA...

CDS

Download CDS FASTA

1512 bp · TkA07G085430|TK1151|CDS

ATGTTTGCATCTATACCGCCCGTAGCAGAAAATATGTCCTGTTTGCTGCCCCAATTCAAGTGCATACCAGATTCTTTTACCATCCAATTCAAAATTCACACTCATCATTCTACAAATCTCCCAAAATGTAGAGAGCCAACTTTTTTCCCTACTCGTTGCGTTTTATCAACTACAGCACCACCCGTATTATCAACCGAATCCACAGTTCTTAACTTAGAGAAGATAAAATTATCATCTTTAGACCTTCATTCAAATTCAGG...

Protein

Download Protein FASTA

503 aa · TkA07G085430|TK1151|PROTEIN

MFASIPPVAENMSCLLPQFKCIPDSFTIQFKIHTHHSTNLPKCREPTFFPTRCVLSTTAPPVLSTESTVLNLEKIKLSSLDLHSNSGANDRPWSSSSSSSTGVLEIENFQLPSLEPRTPRSHNGAAVGQGNTKTTTLPSEFTTTEYAEAAAEAVALAKAALKVAKSAAAMMTLTPPQTQSQTQTPECGPQEPSEEEVGPTPEELELLEAQLSASIAVRSNRQPERKARRLRATEKADAGTVSVKSTGRTRGRPSSASVKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G085430`
TK1151 ID	TkA07G085430
OH-1004 ID	LXL04_027684
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 96.024 / OH-1004 82.990 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G085430

Location Chr07:22325695-22330665 (-)

Description Similar to sigA: RNA polymerase sigma factor SigA (Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08540`	Required for the transition of plastids into chloroplasts by coordinating nuclear and chloroplastic genomes under light conditions.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027684 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006352 DNA-templated transcription initiation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0016987 sigma factor activity Molecular Function

KEGG gene cross-reference

ana:all5263

msb:LJ00_13680

msg:MSMEI_2684

msm:MSMEG_2752

syf:Synpcc7942_0649

syf:Synpcc7942_0672

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.943

Rank 1 · TkA07G085430 · TK1151

Mitochondrion0.056

Rank 2 · TkA07G085430 · TK1151

Nucleus0.040

Rank 3 · TkA07G085430 · TK1151

Cytoplasm0.024

Rank 4 · TkA07G085430 · TK1151

Cell membrane0.013

Rank 5 · TkA07G085430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04539Sigma70_r3191-197 aa

PF00140Sigma70_r1_2278-301 aa

PF04539Sigma70_r3300-330 aa

PF00140Sigma70_r1_2332-343 aa

PF04542Sigma70_r2348-417 aa

PF04539Sigma70_r3430-482 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G085430	`PF04539`	Sigma70_r3	191	197	2.2e-09	38.0
TkA07G085430	`PF00140`	Sigma70_r1_2	278	301	2.2e-05	25.0
TkA07G085430	`PF04539`	Sigma70_r3	300	330	2.2e-09	38.0
TkA07G085430	`PF00140`	Sigma70_r1_2	332	343	2.2e-05	25.0
TkA07G085430	`PF04542`	Sigma70_r2	348	417	4.2e-19	68.8
TkA07G085430	`PF04539`	Sigma70_r3	430	482	2.2e-09	38.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22056`	Arabidopsis thaliana	sp\|O22056\|SIGB_ARATH RNA polymerase sigma factor sigB	40.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card