TkA07G078930 | RubberDandelionOmics

Gene overview

TkA07G078930

Reference: TK1151 Chr: Chr07 Coordinates: 20572691-20582868 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

879 bp · TkA07G078930|TK1151|CDS

ATGAGTTCTAACGAAATGGAGGTGAAGCGGCGGGCTGTGAAGGCGCTGGTTGGGAAACTGAGCTCGGTATCCGAGCATACTCGTACGGAATCGCTTTGCGAGCTTCGTCTCATGTCGAAGAACGATCCTGATAGTCGAATCTTAATTGCTGAATCAGGTGCGATTCCGTACCTCTCCGAGATACTCTACTCTCCATCTGCTATTGCACAGGAGAACGCAACTGCTACACTACTTAACATCTCGATCTCCTCACGGGAACC...

Protein

Download Protein FASTA

292 aa · TkA07G078930|TK1151|PROTEIN

MSSNEMEVKRRAVKALVGKLSSVSEHTRTESLCELRLMSKNDPDSRILIAESGAIPYLSEILYSPSAIAQENATATLLNISISSREPLMSTRGLLDALSHALRNPASPSTTQSAAATIFSLLTVDSYRPIIGSKRDILYALIDIIRNPNSHPRSIKDALKALFGISLYPLNRATVIELGAVPALFSLVVKDGRLGVVEDATAVIAQIAGCEEAGDAFRKVSGVGVLVDLLDLSTGSSARTKENAVSGLLNMVQCGKKDVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G078930`
TK1151 ID	TkA07G078930
OH-1004 ID	LXL04_030700
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	31.400
Protein coverage (%)	TK1151 80.137 / OH-1004 33.866 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G078930

Location Chr07:20572691-20582868 (-)

Description Similar to PUB19: U-box domain-containing protein 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42340`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030700 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0009609 response to symbiotic bacterium Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009877 nodulation Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G10560

ath:AT1G29340

ath:AT1G60190

dosa:Os06g0102700

mtr:11430446

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.515

Rank 1 · TkA07G078930 · TK1151

Nucleus0.502

Rank 2 · TkA07G078930 · TK1151

Cell membrane0.083

Rank 3 · TkA07G078930 · TK1151

Lysosome / Vacuole0.038

Rank 4 · TkA07G078930 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkA07G078930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24768ARM_ARMC58-189 aa

PF00514Arm12-32 aa

PF25598ARM_PUB13-254 aa

PF00514Arm42-81 aa

PF00514Arm93-119 aa

PF24768ARM_ARMC5136-254 aa

PF00514Arm141-162 aa

PF00514Arm171-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G078930	`PF24768`	ARM_ARMC5	8	189	1e-10	42.2
TkA07G078930	`PF00514`	Arm	12	32	3.5e-16	59.3
TkA07G078930	`PF25598`	ARM_PUB	13	254	2.3e-16	60.8
TkA07G078930	`PF00514`	Arm	42	81	3.5e-16	59.3
TkA07G078930	`PF00514`	Arm	93	119	3.5e-16	59.3
TkA07G078930	`PF24768`	ARM_ARMC5	136	254	1e-10	42.2
TkA07G078930	`PF00514`	Arm	141	162	3.5e-16	59.3
TkA07G078930	`PF00514`	Arm	171	208	3.5e-16	59.3
TkA07G078930	`PF19427`	Insc_C	175	245	0.011	15.0
TkA07G078930	`PF24768`	ARM_ARMC5	207	252	1e-10	42.2
TkA07G078930	`PF00514`	Arm	220	251	3.5e-16	59.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q681N2`	Arabidopsis thaliana	sp\|Q681N2\|PUB15_ARATH U-box domain-containing protein 15	44.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card