TkA07G063970 | RubberDandelionOmics

Gene overview

TkA07G063970

Reference: TK1151 Chr: Chr07 Coordinates: 16915353-16917787 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2352 bp · TkA07G063970|TK1151|cDNA

AGTCATATATTTGTTTAAAAATATACATATGTTGTATAACAAAAAAAGTATATAGAATTAATTTCAACTATCTAACATAGTTGAAAGACCCGATGTAGAAAAAAAGAAATTGGACGGTTGAGGCGTCAATTTTGATGTGGAAAAACCCTAGAAATAACTACAGAAAGGTTTCAACGTTCAAGAACCCCAAATTACCCACTAAAAACACCATTTCTACCATTGTCAGCCGTTTAATCTGAAGTTGGCTTTTGCTCTTGTCA...

CDS

Download CDS FASTA

1422 bp · TkA07G063970|TK1151|CDS

ATGGATACATGGATGGTTGCAGTAGCTGCTGGTGCAGGCTATATAGCCCAACATTTCAAAAAATTCAAGCAGACAGGTGAACACATATCATCAGAATCATCATCTTTCAACTCTTCCATTAATGGCAACTCCAATTCCCCAAAGCAACCTCCCAACAAAAAATGCCCCTTCCGCATGTCCAGAAAGAGAGATAACTCTAAACAAGATGATCTTCAAGGTGTTTCTAGTAGTACAAATGTGACTTCAACTAGTGAGTTCGA...

Protein

Download Protein FASTA

473 aa · TkA07G063970|TK1151|PROTEIN

MDTWMVAVAAGAGYIAQHFKKFKQTGEHISSESSSFNSSINGNSNSPKQPPNKKCPFRMSRKRDNSKQDDLQGVSSSTNVTSTSEFDNEGRNVFSPRSRMLLRNRRPVKPLTSLKSCLMAQLHFDHVEMKEYFGTPFASPSSKTIRPFLVTDGNKVINRSSGGTFIESSETIENNDAMLHVCIGMSFGILYSFMANRREVERLNRLLKQTESLVQDLEEELELKDSVTMQELTIDYHKSQITDDVPPHNLDQYNNDNNSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G063970`
TK1151 ID	TkA07G063970
OH-1004 ID	LXL04_008701
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G063970`
Location	Chr07:16915353-16917787 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008701` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.357

Rank 1 · TkA07G063970 · TK1151

Nucleus0.278

Rank 2 · TkA07G063970 · TK1151

Cytoplasm0.220

Rank 3 · TkA07G063970 · TK1151

Cell membrane0.180

Rank 4 · TkA07G063970 · TK1151

Endoplasmic reticulum0.095

Rank 5 · TkA07G063970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30915POLAR21-43 aa

PF30915POLAR156-377 aa

PF05478Prominin179-218 aa

PF06305LapA_dom182-212 aa

PF06698DUF1192198-209 aa

PF16808PKcGMP_CC206-226 aa

PF16808PKcGMP_CC278-283 aa

PF06698DUF1192278-292 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G063970	`PF30915`	POLAR	21	43	1.4e-14	54.4
TkA07G063970	`PF30915`	POLAR	156	377	1.4e-14	54.4
TkA07G063970	`PF05478`	Prominin	179	218	0.19	10.5
TkA07G063970	`PF06305`	LapA_dom	182	212	0.88	10.2
TkA07G063970	`PF06698`	DUF1192	198	209	4.4	8.2
TkA07G063970	`PF16808`	PKcGMP_CC	206	226	3.7	7.9
TkA07G063970	`PF16808`	PKcGMP_CC	278	283	3.7	7.9
TkA07G063970	`PF06698`	DUF1192	278	292	4.4	8.2
TkA07G063970	`PF06698`	DUF1192	354	372	4.4	8.2
TkA07G063970	`PF06305`	LapA_dom	358	372	0.88	10.2
TkA07G063970	`PF16808`	PKcGMP_CC	359	374	3.7	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card