TkA07G059850 | RubberDandelionOmics

Gene overview

TkA07G059850

Reference: TK1151 Chr: Chr07 Coordinates: 15851323-15852219 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

684 bp · TkA07G059850|TK1151|cDNA

ATGTTCGTCTCTCCCAGATTTCGCCTTGTTCTAATTAGGTTTCTCTCTCTGGTCGGTATCTTAGGTTTGAGTCTCTTCTTCTTTTCAATTTCCATTGATGCTCAAGTCGGTGAAGCGGCACATCCGCCGAAAAAAGATGTTTATTCGGTGTGGGCGATTTCGTCGGAAGATGTGACGGAGAGGATGAAGAAATTGATGGTCGGCCTGCGATCGGAGTTCGGAGGGCCAGAATTTGAGCCGCATGTGACTGTTGTTGGAGC...

CDS

Download CDS FASTA

684 bp · TkA07G059850|TK1151|CDS

ATGTTCGTCTCTCCCAGATTTCGCCTTGTTCTAATTAGGTTTCTCTCTCTGGTCGGTATCTTAGGTTTGAGTCTCTTCTTCTTTTCAATTTCCATTGATGCTCAAGTCGGTGAAGCGGCACATCCGCCGAAAAAAGATGTTTATTCGGTGTGGGCGATTTCGTCGGAAGATGTGACGGAGAGGATGAAGAAATTGATGGTCGGCCTGCGATCGGAGTTCGGAGGGCCAGAATTTGAGCCGCATGTGACTGTTGTTGGAGC...

Protein

Download Protein FASTA

227 aa · TkA07G059850|TK1151|PROTEIN

MFVSPRFRLVLIRFLSLVGILGLSLFFFSISIDAQVGEAAHPPKKDVYSVWAISSEDVTERMKKLMVGLRSEFGGPEFEPHVTVVGAITLTEDEACDKLKKACEGLKSYNATEVMETVVHTAGIISATNPQLVSPTSIFNSTSFTVISSLISTTNIHVTFSASMPHMSILYGDLTEEEKKRAQEIANVLDETVKSLNFPIVRLALYKTDTEDKTLKSWQKVTEITLQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G059850`
TK1151 ID	TkA07G059850
OH-1004 ID	LXL04_027446
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G059850

Location Chr07:15851323-15852219 (+)

Description Similar to At4g18930: Cyclic phosphodiesterase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18930`	Hydrolyzes ADP-ribose 1'',2''-cyclic phosphate (Appr>1) that is produced during tRNA splicing into ADP-ribose 1''-phosphate (Appr-1''p).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027446 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006388 tRNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0009187 cyclic nucleotide metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004112 cyclic-nucleotide phosphodiesterase activity Molecular Function

GO:0004113 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity Molecular Function

KEGG gene cross-reference

ath:AT4G18930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.299

Rank 1 · TkA07G059850 · TK1151

Cytoplasm0.224

Rank 2 · TkA07G059850 · TK1151

Lysosome / Vacuole0.154

Rank 3 · TkA07G059850 · TK1151

Extracellular0.131

Rank 4 · TkA07G059850 · TK1151

Nucleus0.105

Rank 5 · TkA07G059850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07823CPDase50-219 aa

PF135632_5_RNA_ligase254-101 aa

PF24570BACK_BPM_SPOP83-123 aa

PF30483AAA_SpoVK_2nd91-129 aa

PF135632_5_RNA_ligase2164-210 aa

PF30483AAA_SpoVK_2nd183-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G059850	`PF07823`	CPDase	50	219	1.5e-08	35.3
TkA07G059850	`PF13563`	2_5_RNA_ligase2	54	101	0.0003	21.6
TkA07G059850	`PF24570`	BACK_BPM_SPOP	83	123	0.087	13.7
TkA07G059850	`PF30483`	AAA_SpoVK_2nd	91	129	0.041	14.5
TkA07G059850	`PF13563`	2_5_RNA_ligase2	164	210	0.0003	21.6
TkA07G059850	`PF30483`	AAA_SpoVK_2nd	183	196	0.041	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04147`	Arabidopsis thaliana	sp\|O04147\|CPD_ARATH Cyclic phosphodiesterase	40.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card