TkA07G059820 | RubberDandelionOmics

Gene overview

TkA07G059820

Reference: TK1151 Chr: Chr07 Coordinates: 15844368-15845675 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1007 bp · TkA07G059820|TK1151|cDNA

ATAGAACTCTAAACACGTCTAACAACTCATTAATCAAATATTTCCAATTAAAACCCCAAAACAGAATCAATTATAAGAAATGCATAAAAATGGCATCTTCTTCCCGATTCCCAATCATATACCTTCGCTTGAATGTTCATCTCTCCCAGATTTCGCCTTGTTCTAATTAGGTTTCTCTCTCTGGTCGGTATCTTAGGTTTAGCTCTCTTCTTCTTTTCAATTTCCATGGATGCTCAAGTCGGTGAAACGGCACAGCAGCC...

CDS

Download CDS FASTA

660 bp · TkA07G059820|TK1151|CDS

ATGTTCATCTCTCCCAGATTTCGCCTTGTTCTAATTAGGTTTCTCTCTCTGGTCGGTATCTTAGGTTTAGCTCTCTTCTTCTTTTCAATTTCCATGGATGCTCAAGTCGGTGAAACGGCACAGCAGCCGAAAAAGGATGCTTATTCGGTGTGGGCGATTTCGTCGGAAGACGTGACGGAGAGGATGAAGAAATTGATGGTCGGCCTGCGATCGGAGTTCGGAGGGCCAGAATTTGAGCCGCATGTGACTGTTGTTGGAGC...

Protein

Download Protein FASTA

219 aa · TkA07G059820|TK1151|PROTEIN

MFISPRFRLVLIRFLSLVGILGLALFFFSISMDAQVGETAQQPKKDAYSVWAISSEDVTERMKKLMVGLRSEFGGPEFEPHVTVVGAITMTEDEARDKLKKACEGLKSFNATVQKVATGTFFYQCVYLLLHPTTEVMETGAHCWNHFGYKPSTPYMPHMSILYGDLSEEEKKRAQDKANVLDETVKSLSFPIVRLALYKTDTEDKTLKSWEKVTEITLQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G059820`
TK1151 ID	TkA07G059820
OH-1004 ID	LXL04_027446
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G059820

Location Chr07:15844368-15845675 (+)

Description Similar to At4g18930: Cyclic phosphodiesterase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18930`	Hydrolyzes ADP-ribose 1'',2''-cyclic phosphate (Appr>1) that is produced during tRNA splicing into ADP-ribose 1''-phosphate (Appr-1''p).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027446 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006388 tRNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0009187 cyclic nucleotide metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004112 cyclic-nucleotide phosphodiesterase activity Molecular Function

GO:0004113 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity Molecular Function

KEGG gene cross-reference

ath:AT4G18930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.371

Rank 1 · TkA07G059820 · TK1151

Cytoplasm0.270

Rank 2 · TkA07G059820 · TK1151

Mitochondrion0.197

Rank 3 · TkA07G059820 · TK1151

Cell membrane0.128

Rank 4 · TkA07G059820 · TK1151

Golgi apparatus0.124

Rank 5 · TkA07G059820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23474Acb147-85 aa

PF07823CPDase49-210 aa

PF02834LigT_PEase55-117 aa

PF135632_5_RNA_ligase279-202 aa

PF10642Tom5110-110 aa

PF02834LigT_PEase147-200 aa

PF23474Acb1155-183 aa

PF10642Tom5166-179 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G059820	`PF23474`	Acb1	47	85	0.14	12.6
TkA07G059820	`PF07823`	CPDase	49	210	1.9e-10	41.5
TkA07G059820	`PF02834`	LigT_PEase	55	117	0.0044	17.9
TkA07G059820	`PF13563`	2_5_RNA_ligase2	79	202	3.7e-12	47.3
TkA07G059820	`PF10642`	Tom5	110	110	0.42	11.4
TkA07G059820	`PF02834`	LigT_PEase	147	200	0.0044	17.9
TkA07G059820	`PF23474`	Acb1	155	183	0.14	12.6
TkA07G059820	`PF10642`	Tom5	166	179	0.42	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04147`	Arabidopsis thaliana	sp\|O04147\|CPD_ARATH Cyclic phosphodiesterase	59.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card