TkA07G048860 | RubberDandelionOmics

Gene overview

TkA07G048860

Reference: TK1151 Chr: Chr07 Coordinates: 12989549-12992474 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1623 bp · TkA07G048860|TK1151|cDNA

ATCGTCAACTCTTTATCGATGGTTGTTCGATTCGCCACCGTCGTCGCCGTTTCCTCGCCGGAAATCTCCCGTCCGTGTTTATTTTCCGGTATTCCTTCTCCAGTCGTGTTCTTCCTTGTTATTCGATTCATTCATCGAGGAATCAGGCCCATAGTTTTTCGATAGCTATAAAAACTCCGACGCAATCAGTTCAGTGACAATTTGGTAAAAAGTCGATCGATCGTCGATCTGTTCAAGATGGGCGACTCCACCGCCACCAT...

CDS

Download CDS FASTA

1116 bp · TkA07G048860|TK1151|CDS

ATGGGCGACTCCACCGCCACCATCAGTGGCGGTGATAATAACTCGTCTGAGAGAAACGCGGCGGAAGAAGTTTGTAGAATCGTGGAACAGAGCAAAGAGTTACAGGATTCGGCAGCAACCATAATTTCTCGAAACACCCAAGAGGAAGCGTCACTAAGGCAACGAGCCCTAGCCCTCGATTCAAGCATCAAAAGGCTCCATTCGTACATTGCTTCTTCCGTCAAGAAAGGGAATTTGGATCCAAAAGATGCCGAAAAATT...

Protein

Download Protein FASTA

371 aa · TkA07G048860|TK1151|PROTEIN

MGDSTATISGGDNNSSERNAAEEVCRIVEQSKELQDSAATIISRNTQEEASLRQRALALDSSIKRLHSYIASSVKKGNLDPKDAEKFVEELSRARYTLSEGDAAVFLPCKSYGRFLKMFLGPINVHATRKDVQLKVKEEYNNFRDRTAYLFLFFPSLLLLLRSWVWNGCFPALPVQMYQAWLLFLYTGLALRENILRVNGSDIRPWWIYHHYCAMLMALISLTWEIERQPDCSQKQKGIQLFLKWAIMQGVAMLLQNRYQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G048860`
TK1151 ID	TkA07G048860
OH-1004 ID	LXL04_027313
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G048860`
Location	Chr07:12989549-12992474 (+)
Description	Similar to tmem120: Transmembrane protein 120 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027313` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0034220 monoatomic ion transmembrane transport Biological Process GO:0045089 positive regulation of innate immune response Biological Process GO:0050829 defense response to Gram-negative bacterium Biological Process GO:0051291 protein heterooligomerization Biological Process GO:0005637 nuclear inner membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0005216 monoatomic ion channel activity Molecular Function GO:0120225 coenzyme A binding Molecular Function
KEGG gene cross-reference	ddi:DDB_G0288699 dme:Dmel_CG32795 dre:100005623 hsa:144404 mmu:330189 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.528

Rank 1 · TkA07G048860 · TK1151

Cell membrane0.249

Rank 2 · TkA07G048860 · TK1151

Golgi apparatus0.227

Rank 3 · TkA07G048860 · TK1151

Cytoplasm0.148

Rank 4 · TkA07G048860 · TK1151

Nucleus0.091

Rank 5 · TkA07G048860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10224DUF220516-44 aa

PF19717DUF621217-113 aa

PF11727ISG65-7518-93 aa

PF07851TMEM120A-B25-353 aa

PF10224DUF220546-82 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G048860	`PF10224`	DUF2205	16	44	0.52	11.1
TkA07G048860	`PF19717`	DUF6212	17	113	0.24	11.0
TkA07G048860	`PF11727`	ISG65-75	18	93	0.19	12.1
TkA07G048860	`PF07851`	TMEM120A-B	25	353	1.4e-94	317.7
TkA07G048860	`PF10224`	DUF2205	46	82	0.52	11.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card