TkA07G048450 | RubberDandelionOmics

Gene overview

TkA07G048450

Reference: TK1151 Chr: Chr07 Coordinates: 12863248-12867939 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2486 bp · TkA07G048450|TK1151|cDNA

ATGAAATTAAGATCATAACCAAATCCAGAATAAGACCTAAAAAAGTCAGTAACCTCATGACAAATTCTGCAGTTTATTCAAACTAAAATTATAGGGCAGGAGTTCTTCCCGTAACTACTCAAAGCTCTGGTTCTACTGTATACTTCAATCAATTCAAATGTCGCAATTTTGGAAGCCAGGGACGGCGAAGCCTCGCCTGCTCGACGACGAAGAAGGCGGCGTTCTTTTCTACTCCGCTTCCCCCTCCTCCTCATCCACAT...

CDS

Download CDS FASTA

2088 bp · TkA07G048450|TK1151|CDS

ATGTCGCAATTTTGGAAGCCAGGGACGGCGAAGCCTCGCCTGCTCGACGACGAAGAAGGCGGCGTTCTTTTCTACTCCGCTTCCCCCTCCTCCTCATCCACATATGGGTTTGCGAGCTTAGAGAGCCAGAGGCACCGATTACCTGTATTCAAGTACAGAACGCAAATTCTATATCTGGTGGAGACTCACTCCACTACCATAATAGTCGGCGAAACAGGGAGTGGGAAAACGACTCAAATCCCTCAGTATCTTAAGGAAGC...

Protein

Download Protein FASTA

695 aa · TkA07G048450|TK1151|PROTEIN

MSQFWKPGTAKPRLLDDEEGGVLFYSASPSSSSTYGFASLESQRHRLPVFKYRTQILYLVETHSTTIIVGETGSGKTTQIPQYLKEAGWADGGRIIACTQPRRLAVQSVAARVAEEMGVKLGEEVGYTIRFEDVTNSEFTRIKFLTDGVLLREMMDDPLLSKYSVIMVDEAHERSVSTDILLGLLKKIQRRRPELRLIIASATIEAKSMAEFFHNRKRRAQLEGEDNKLQIEPAILSVEGRGYNVEMFYVEEPVSDYLQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G048450`
TK1151 ID	TkA07G048450
OH-1004 ID	LXL04_027311
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G048450

Location Chr07:12863248-12867939 (+)

Description Similar to At4g18465: Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18465`	May be involved in pre-mRNA splicing.	No verified direct reference in this release
`At1g32490`	Involved in pre-mRNA splicing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027311 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016604 nuclear body Cellular Component

GO:0071006 U2-type catalytic step 1 spliceosome Cellular Component

GO:0071007 U2-type catalytic step 2 spliceosome Cellular Component

GO:0071013 catalytic step 2 spliceosome Cellular Component

KEGG gene cross-reference

ath:AT4G18465

ddi:DDB_G0291183

hsa:60625

mmu:217207

pon:100172442

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.437

Rank 1 · TkA07G048450 · TK1151

Cytoplasm0.433

Rank 2 · TkA07G048450 · TK1151

Mitochondrion0.107

Rank 3 · TkA07G048450 · TK1151

Peroxisome0.089

Rank 4 · TkA07G048450 · TK1151

Plastid0.061

Rank 5 · TkA07G048450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12775AAA_752-86 aa

PF20720nSTAND357-81 aa

PF13086AAA_1158-150 aa

PF00270DEAD59-210 aa

PF00437T2SSE59-86 aa

PF04851ResIII61-176 aa

PF13401AAA_2262-190 aa

PF13245AAA_1962-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G048450	`PF12775`	AAA_7	52	86	0.036	14.3
TkA07G048450	`PF20720`	nSTAND3	57	81	0.076	13.4
TkA07G048450	`PF13086`	AAA_11	58	150	0.099	13.1
TkA07G048450	`PF00270`	DEAD	59	210	3.6e-08	34.1
TkA07G048450	`PF00437`	T2SSE	59	86	0.14	11.5
TkA07G048450	`PF04851`	ResIII	61	176	0.054	14.1
TkA07G048450	`PF13401`	AAA_22	62	190	3e-07	31.5
TkA07G048450	`PF13245`	AAA_19	62	191	0.00024	22.0
TkA07G048450	`PF13604`	AAA_30	62	198	0.00091	19.8
TkA07G048450	`PF13476`	AAA_23	62	78	0.15	13.4
TkA07G048450	`PF13555`	AAA_29	62	79	0.17	12.4
TkA07G048450	`PF25199`	nSTAND_NTPase5	64	103	0.17	12.4
TkA07G048450	`PF00448`	SRP54	65	123	0.34	11.2
TkA07G048450	`PF00437`	T2SSE	139	152	0.14	11.5
TkA07G048450	`PF25199`	nSTAND_NTPase5	164	208	0.17	12.4
TkA07G048450	`PF22590`	Cas3-like_C_2	176	206	0.092	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JRJ6`	Arabidopsis thaliana	sp\|F4JRJ6\|DEAH9_ARATH Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH9	75.000%	Swiss-Prot	High
`Q8VY00`	Arabidopsis thaliana	sp\|Q8VY00\|ESP3_ARATH Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH1	48.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card