TkA07G046210 | RubberDandelionOmics

Gene overview

TkA07G046210

Reference: TK1151 Chr: Chr07 Coordinates: 12344564-12346815 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1167 bp · TkA07G046210|TK1151|cDNA

ATGTCCGAAAATGATGATGATGACCTAACTGAAGAAGAAAAGATGTTAAAGGAGGCTCTGAAGAAGAGTCTAATAAATCAAAAAGGCGGAGTAGGTACGTCGGGCTCCTCAACCATTCCAATGCATGATTCCTGGGATCAAGACCAGATCAAGGAGGCTTTAACCCGAAGCCTCATGGATCAAGGTCCTCTGAGACCAACATATGGTCCAGTCTCACTATGGAATCATCAAGCAACGATCGGAGACTCGGATCTAAAGCC...

CDS

Download CDS FASTA

1167 bp · TkA07G046210|TK1151|CDS

ATGTCCGAAAATGATGATGATGACCTAACTGAAGAAGAAAAGATGTTAAAGGAGGCTCTGAAGAAGAGTCTAATAAATCAAAAAGGCGGAGTAGGTACGTCGGGCTCCTCAACCATTCCAATGCATGATTCCTGGGATCAAGACCAGATCAAGGAGGCTTTAACCCGAAGCCTCATGGATCAAGGTCCTCTGAGACCAACATATGGTCCAGTCTCACTATGGAATCATCAAGCAACGATCGGAGACTCGGATCTAAAGCC...

Protein

Download Protein FASTA

388 aa · TkA07G046210|TK1151|PROTEIN

MSENDDDDLTEEEKMLKEALKKSLINQKGGVGTSGSSTIPMHDSWDQDQIKEALTRSLMDQGPLRPTYGPVSLWNHQATIGDSDLKPHKSYKIPTNFQQNIDLPLSPNAHYYSRADQSEQQISEADFPNLNHSDILTIARHFEEQRFRTHTATTPFLAASYFLRDYVTDIGRIDFDLFEIFSDNPPNAPDLSLPSFEGRITGPTDNPELGFIFHVKGKGQLGLIALLYGKIASANVVTHDSTSENLAGIFISQRQYVLKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G046210`
TK1151 ID	TkA07G046210
OH-1004 ID	LXL04_020522
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.900
Protein coverage (%)	TK1151 43.299 / OH-1004 75.100 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G046210

Location Chr07:12344564-12346815 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: P92519`	Uncharacterized mitochondrial protein AtMg00810.	No verified direct reference in this release
`UniProt: P93290`	Uncharacterized mitochondrial protein AtMg00240.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020522 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.520

Rank 1 · TkA07G046210 · TK1151

Nucleus0.444

Rank 2 · TkA07G046210 · TK1151

Mitochondrion0.103

Rank 3 · TkA07G046210 · TK1151

Cell membrane0.056

Rank 4 · TkA07G046210 · TK1151

Endoplasmic reticulum0.054

Rank 5 · TkA07G046210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	46.400%	Swiss-Prot	Low
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	45.500%	Swiss-Prot	Low
`P92519`	Arabidopsis thaliana	sp\|P92519\|M810_ARATH Uncharacterized mitochondrial protein AtMg00810	34.300%	Swiss-Prot	Low
`P93290`	Arabidopsis thaliana	sp\|P93290\|M240_ARATH Uncharacterized mitochondrial protein AtMg00240	56.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card