TkA07G044510 | RubberDandelionOmics

Gene overview

TkA07G044510

Reference: TK1151 Chr: Chr07 Coordinates: 11831920-11833254 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1004 bp · TkA07G044510|TK1151|cDNA

TAATTTAATCATTTTTCTCTCTTATAAGTCTTTTCACTATCTTCATTCATCAAACACCTTGTAGTTTGTGTGTTTTTGTTGCATGCATGTTGTTGTAGGGTTTGTAGAACTTGAGTTTAACAGATGGAGATGGAGGAGGGTTTGGTTGTGAGAGGGAGGGTGGAAATTGATACACGAAAACCGTTCAAATCGGTAAAAGAAGCCGTTATGTTATTTGGAGAAAAGGTTTTAGCCGGCGAGGTTTATGCCAACAAACTCAA...

CDS

Download CDS FASTA

624 bp · TkA07G044510|TK1151|CDS

ATGGAGATGGAGGAGGGTTTGGTTGTGAGAGGGAGGGTGGAAATTGATACACGAAAACCGTTCAAATCGGTAAAAGAAGCCGTTATGTTATTTGGAGAAAAGGTTTTAGCCGGCGAGGTTTATGCCAACAAACTCAAAGAGATGGAAAGCATAGAGAGGGAAAACAACCAACAACAAACAAAAGTCGGACTTGGAGAAGCAAAACAAACCGTTGAAAAGGCAAAAGATAATGCAAAGCTAATGGCTTATTACCTTACATC...

Protein

Download Protein FASTA

207 aa · TkA07G044510|TK1151|PROTEIN

MEMEEGLVVRGRVEIDTRKPFKSVKEAVMLFGEKVLAGEVYANKLKEMESIERENNQQQTKVGLGEAKQTVEKAKDNAKLMAYYLTSLKEQLEETKLELNQLKSTGGPYTSYHTPINPDIEEIKFMENPKPVQMNPTTIVKSEPTDDHHLVESKHNDLVKFDDSPPSKVIVEVPKMQERNPSSFKTKKTKKKPLIPLLGGIFSKSKG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G044510`
TK1151 ID	TkA07G044510
OH-1004 ID	LXL04_013819
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 77.239 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G044510

Location Chr07:11831920-11833254 (+)

Description Similar to At1g75720: WEB family protein At1g75720

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75720`	WEB family protein At1g75720.	No verified direct reference in this release
`At3g51220`	WEB family protein At3g51220.	No verified direct reference in this release
`At2g17940`	WEB family protein At2g17940.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013819 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G75720

ath:AT2G17940

ath:AT3G51220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.604

Rank 1 · TkA07G044510 · TK1151

Nucleus0.291

Rank 2 · TkA07G044510 · TK1151

Cytoplasm0.266

Rank 3 · TkA07G044510 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA07G044510 · TK1151

Plastid0.037

Rank 5 · TkA07G044510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701WEMBL13-33 aa

PF05701WEMBL45-106 aa

PF15689NRIP1_repr_3140-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G044510	`PF05701`	WEMBL	13	33	8.5e-09	35.4
TkA07G044510	`PF05701`	WEMBL	45	106	8.5e-09	35.4
TkA07G044510	`PF15689`	NRIP1_repr_3	140	198	0.028	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I0N3`	Arabidopsis thaliana	sp\|F4I0N3\|Y1572_ARATH WEB family protein At1g75720	36.500%	Swiss-Prot	Medium
`Q9SD24`	Arabidopsis thaliana	sp\|Q9SD24\|Y3122_ARATH WEB family protein At3g51220	32.300%	Swiss-Prot	Medium
`O48822`	Arabidopsis thaliana	sp\|O48822\|Y2794_ARATH WEB family protein At2g17940	30.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card