TkA07G037460 | RubberDandelionOmics

Gene overview

TkA07G037460

Reference: TK1151 Chr: Chr07 Coordinates: 9969162-9973471 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1411 bp · TkA07G037460|TK1151|cDNA

CTTATTACATATAGATGGCACCAGCTTCACGTCTCAACGCAAATCAGCTAGCCCAAGTTCGGGAACTCATCGCCCAAGAGTTCAACAATGCCTTCAACGAGGTCATACCCGACGTGACCGCAAACATCATCAATCAAGTTCGTGCTCTTCTCGACGAACGCCTCGCTGCTGGGCCTCCTCCTGTTGCTCCTGTGCCTCCCGCACGTGATCTGATGTACTACTACGAGAAGTTCGGGAAATGTAACCCGCCGCACTGGGAT...

CDS

Download CDS FASTA

1158 bp · TkA07G037460|TK1151|CDS

ATGGCACCAGCTTCACGTCTCAACGCAAATCAGCTAGCCCAAGTTCGGGAACTCATCGCCCAAGAGTTCAACAATGCCTTCAACGAGGTCATACCCGACGTGACCGCAAACATCATCAATCAAGTTCGTGCTCTTCTCGACGAACGCCTCGCTGCTGGGCCTCCTCCTGTTGCTCCTGTGCCTCCCGCACGTGATCTGATGTACTACTACGAGAAGTTCGGGAAATGTAACCCGCCGCACTGGGATGGGGAAGATGACCC...

Protein

Download Protein FASTA

385 aa · TkA07G037460|TK1151|PROTEIN

MAPASRLNANQLAQVRELIAQEFNNAFNEVIPDVTANIINQVRALLDERLAAGPPPVAPVPPARDLMYYYEKFGKCNPPHWDGEDDPVAAKHWLSDIEGAFMTIGCPDQFRVLVAKNHLRKRGKTWWNTVTGQMNEEAVRAITWTQFVQWFEARYVPRVEQQRMMLEFMALQQTTESVSELNAKFMEMLSFCPTFAGDEAWLVSRYTSILRTDIREFVGMQDFETLADVMGAARKREIELQAQSKRKAESTSSKLSEGAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G037460`
TK1151 ID	TkA07G037460
OH-1004 ID	LXL04_016247
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	73.700
Protein coverage (%)	TK1151 96.104 / OH-1004 16.373 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G037460`
Location	Chr07:9969162-9973471 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016247` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.677

Rank 1 · TkA07G037460 · TK1151

Nucleus0.446

Rank 2 · TkA07G037460 · TK1151

Endoplasmic reticulum0.063

Rank 3 · TkA07G037460 · TK1151

Mitochondrion0.057

Rank 4 · TkA07G037460 · TK1151

Cell membrane0.053

Rank 5 · TkA07G037460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03732PEG10_N-capsid76-156 aa

PF19259Ty3_capsid80-262 aa

PF12511DUF3716279-330 aa

PF14392zf-CCHC_4285-302 aa

PF00098zf-CCHC286-301 aa

PF05676NDUF_B7287-303 aa

PF16588zf-C2H2_10287-300 aa

PF05676NDUF_B7318-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G037460	`PF03732`	PEG10_N-capsid	76	156	1.2e-11	45.5
TkA07G037460	`PF19259`	Ty3_capsid	80	262	2.1e-13	50.9
TkA07G037460	`PF12511`	DUF3716	279	330	0.41	11.3
TkA07G037460	`PF14392`	zf-CCHC_4	285	302	0.098	13.0
TkA07G037460	`PF00098`	zf-CCHC	286	301	1.4e-07	32.0
TkA07G037460	`PF05676`	NDUF_B7	287	303	3.2	8.2
TkA07G037460	`PF16588`	zf-C2H2_10	287	300	7.7	7.1
TkA07G037460	`PF05676`	NDUF_B7	318	334	3.2	8.2
TkA07G037460	`PF27939`	DUF8363	319	336	0.7	10.5
TkA07G037460	`PF00098`	zf-CCHC	320	336	1.4e-07	32.0
TkA07G037460	`PF14392`	zf-CCHC_4	320	336	0.098	13.0
TkA07G037460	`PF16588`	zf-C2H2_10	324	336	7.7	7.1
TkA07G037460	`PF03732`	PEG10_N-capsid	372	385	1.2e-11	45.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card