TkA07G023840 | RubberDandelionOmics

Gene overview

TkA07G023840

Reference: TK1151 Chr: Chr07 Coordinates: 6466696-6468467 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · TkA07G023840|TK1151|cDNA

ATGGATTTTGTGATGCGACTCCCAAGAACAAGTAAAGGAAACGATGCCATTTGGGTAATAGTGGATAGATTGACAAAAAGTTCTTTGTTTCTAGCGATAAAAGAAAATACTCCTTTGGAAAAGCTTGCAAAAATTTATGTTGATAAAGTAGTGAGACTTCATGGTGTACCACTTACCATAGTGTCGGATAGAGATGCTAGATTTACTTCACGTTTTTGGAAGTCTTTACAAGAAGAATTGGGGACAAAACTACACTTAAG...

CDS

Download CDS FASTA

1098 bp · TkA07G023840|TK1151|CDS

ATGGATTTTGTGATGCGACTCCCAAGAACAAGTAAAGGAAACGATGCCATTTGGGTAATAGTGGATAGATTGACAAAAAGTTCTTTGTTTCTAGCGATAAAAGAAAATACTCCTTTGGAAAAGCTTGCAAAAATTTATGTTGATAAAGTAGTGAGACTTCATGGTGTACCACTTACCATAGTGTCGGATAGAGATGCTAGATTTACTTCACGTTTTTGGAAGTCTTTACAAGAAGAATTGGGGACAAAACTACACTTAAG...

Protein

Download Protein FASTA

365 aa · TkA07G023840|TK1151|PROTEIN

MDFVMRLPRTSKGNDAIWVIVDRLTKSSLFLAIKENTPLEKLAKIYVDKVVRLHGVPLTIVSDRDARFTSRFWKSLQEELGTKLHLSTAYHSQTDGQTERTNQTLEDMLRSCVIDFGGKWDDHLPLVKFSYNNSYHSSIGMPPYEALYGRKCRTPLCWLEVGEKKLTGPDLVRVTNEKIEMIQAKMKAAQDRQRSYASLKQRSYDLKIGDLMMLKVSPWKWVMRFGKKGKLSPSPIKICNDLEKIRSRFFWGVDDGKRKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G023840`
TK1151 ID	TkA07G023840
OH-1004 ID	LXL04_009282
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	82.600
Protein coverage (%)	TK1151 65.205 / OH-1004 60.401 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G023840`
Location	Chr07:6466696-6468467 (-)
Description	Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009282` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function
KEGG gene cross-reference	sce:YGR109W-B sce:YIL082W-A spo:2538755 spo:2541833 spo:2541991 spo:3361422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.339

Rank 1 · TkA07G023840 · TK1151

Nucleus0.315

Rank 2 · TkA07G023840 · TK1151

Mitochondrion0.088

Rank 3 · TkA07G023840 · TK1151

Peroxisome0.086

Rank 4 · TkA07G023840 · TK1151

Plastid0.065

Rank 5 · TkA07G023840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00665rve1-92 aa

PF11976Rad60-SLD19-49 aa

PF29688TnsB_C47-110 aa

PF15007CEP4454-112 aa

PF00665rve99-118 aa

PF26700IPGAL1_C178-241 aa

PF24626SH3_Tf2-1209-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G023840	`PF00665`	rve	1	92	1.1e-05	26.3
TkA07G023840	`PF11976`	Rad60-SLD	19	49	0.22	12.1
TkA07G023840	`PF29688`	TnsB_C	47	110	1.4e-05	25.7
TkA07G023840	`PF15007`	CEP44	54	112	0.16	12.8
TkA07G023840	`PF00665`	rve	99	118	1.1e-05	26.3
TkA07G023840	`PF26700`	IPGAL1_C	178	241	0.35	11.3
TkA07G023840	`PF24626`	SH3_Tf2-1	209	236	0.11	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card