Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1517 bp · TkA07G022250|TK1151|cDNA
AATACTCTTGTTCTGTTCTGTCCCATCTAATTCTTCCTACCAAACGCACCCTAATGGTACAAGGACCAATTTTGTCCATGTTTTTGAAGTTTTACAATAAGTGTCTATTCACCAAACCATAGGGACTATTCATGTATTTTTGAATTTATAGCAATTTTATCCATAGATGTTTGCATTGTGGGAGTTGCACGAACACCAATAGGGGACTTCCTTGGTTCTCTTTCATCTCTCCCAGCTACCAAACTTGGATCAATAGTGAT...
861 bp · TkA07G022250|TK1151|CDS
ATGAAAGCAACAATGATTGGTGCACAAAGCATTCAAGTAGGTGTTAATGATATTGTAGTGGCTGGTGGCATGGAAAGCATGTCTAATATACCGAAATATGTAGAAGGGTCAAGAGAGGGATCTCGGGTAGGCCATGATGTCATCATTGATGGCATGGTTAAAGATGGTATTTGGGATGTTTACAATGAATTTGTAATGGTAGTATGTGGTGAGATATGTGCTGAAAACTTCAAGATAACAAGAGAAGATCAAGATAACTC...
Protein
Download Protein FASTA286 aa · TkA07G022250|TK1151|PROTEIN
MKATMIGAQSIQVGVNDIVVAGGMESMSNIPKYVEGSREGSRVGHDVIIDGMVKDGIWDVYNEFVMVVCGEICAENFKITREDQDNSAVKSFNRRITAQNKGAFKWEIVPVEVSLGKGKGTTIVDKDKGLTKFDEKKLRSLRPCFKVEGGSGSAGNASSISDGAAALVLVSGKRALELGLKVIAKIRGFGDAAQAPELFLTAPSLAIPKAISNAGLTASQIDYYEINEAFSVVALANQKLLGIGDEQINVHGGAVSLGHP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G022250 |
|---|---|
| TK1151 ID | TkA07G022250 |
| OH-1004 ID | LXL04_000865 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 34.200 |
| Protein coverage (%) | TK1151 95.455 / OH-1004 61.239Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G022250 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:6053988-6057702 (+) | |||||||||
| Description | Similar to PED1: 3-ketoacyl-CoA thiolase 2, peroxisomal | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000038 very long-chain fatty acid metabolic process Biological Process GO:0006633 fatty acid biosynthetic process Biological Process GO:0006635 fatty acid beta-oxidation Biological Process GO:0008206 bile acid metabolic process Biological Process GO:0009611 response to wounding Biological Process GO:0009695 jasmonic acid biosynthetic process Biological Process GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process GO:0010111 glyoxysome organization Biological Process GO:0010124 phenylacetate catabolic process Biological Process GO:0010597 green leaf volatile biosynthetic process Biological Process GO:0031408 oxylipin biosynthetic process Biological Process GO:0033540 fatty acid beta-oxidation using acyl-CoA oxidase Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G04710 ath:AT2G33150 ath:AT5G48880 hsa:30 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00108Thiolase_N1-171 aaPF15635Tox-GHH2115-170 aaPF02803Thiolase_C180-284 aaPF22691Thiolase_C_1193-239 aaPF22691Thiolase_C_1248-278 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G022250 | PF00108 | Thiolase_N | 1 | 171 | 3.8e-48 | 164.9 |
| TkA07G022250 | PF15635 | Tox-GHH2 | 115 | 170 | 0.19 | 12.7 |
| TkA07G022250 | PF02803 | Thiolase_C | 180 | 284 | 5.7e-36 | 123.6 |
| TkA07G022250 | PF22691 | Thiolase_C_1 | 193 | 239 | 0.00017 | 22.1 |
| TkA07G022250 | PF22691 | Thiolase_C_1 | 248 | 278 | 0.00017 | 22.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.