TkA07G019040 | RubberDandelionOmics

Gene overview

TkA07G019040

Reference: TK1151 Chr: Chr07 Coordinates: 5164261-5170900 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · TkA07G019040|TK1151|cDNA

ATGGCGACTATGGAGAGCTTGATCGGTTTGGTAAATCGTATACAAAGAGCTTGTACTGCTCTCGGTGACTACGGCGGCGGAGACTCCACTTTTTCATCTCTATGGGACGCTCTTCCTTCTGTTGCGGTTGTCGGCGGTCAAAGTTCTGGAAAGTCTTCAGTGTTAGAAAGTATTGTAGGGAGGGATTTTCTTCCTAGAGGATCTGCATTGGTACGTAAGGAAATTGCAGATGAAACAGACAGAATCACAGGGAAGTCAAA...

CDS

Download CDS FASTA

1338 bp · TkA07G019040|TK1151|CDS

ATGGCGACTATGGAGAGCTTGATCGGTTTGGTAAATCGTATACAAAGAGCTTGTACTGCTCTCGGTGACTACGGCGGCGGAGACTCCACTTTTTCATCTCTATGGGACGCTCTTCCTTCTGTTGCGGTTGTCGGCGGTCAAAGTTCTGGAAAGTCTTCAGTGTTAGAAAGTATTGTAGGGAGGGATTTTCTTCCTAGAGGATCTGCATTGGTACGTAAGGAAATTGCAGATGAAACAGACAGAATCACAGGGAAGTCAAA...

Protein

Download Protein FASTA

445 aa · TkA07G019040|TK1151|PROTEIN

MATMESLIGLVNRIQRACTALGDYGGGDSTFSSLWDALPSVAVVGGQSSGKSSVLESIVGRDFLPRGSALVRKEIADETDRITGKSKQISPIPIHLSIYSPNEGQSENIVEDIENMVRLYVEKPNSIILAISPANQDIATSDAINLLKRRAYRLQHPWVGIVNRSQADINKNTDMMYARRREREYFATSPDYGHLASKMGSEYLAKLLSQHLETVIKQKIPGITSLITKGIEDMEAELDRLGRPIAVMQGSAQLYTILEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G019040`
TK1151 ID	TkA07G019040
OH-1004 ID	LXL04_022574
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	40.700
Protein coverage (%)	TK1151 85.169 / OH-1004 51.736 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G019040

Location Chr07:5164261-5170900 (-)

Description Similar to Dynamin-related protein 5A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60190`	Microtubule-associated force-producing protein that is targeted to the tubulo-vesicular network of the forming cell plate during cytokinesis.	Members of the Arabidopsis dynamin-like gene family, ADL1, are essential for plant cytokinesis and polarized cell growth.2003 · DOI: 10.1105/tpc.009670 Phragmoplastin dynamics: multiple forms, microtubule association and their roles in cell plate formation in plants.2003 · DOI: 10.1023/b:plan.0000006936.50532.3a
`At1g14830`	Microtubule-associated force-producing protein that is targeted to the growing edges of the cell plate during cytokinesis.	The dynamin-like protein ADL1C is essential for plasma membrane maintenance during pollen maturation.2003 · DOI: 10.1046/j.1365-313x.2003.01775.x Phragmoplastin dynamics: multiple forms, microtubule association and their roles in cell plate formation in plants.2003 · DOI: 10.1023/b:plan.0000006936.50532.3a Comparison of the dynamics and functional redundancy of the Arabidopsis dynamin-related isoforms DRP1A and DRP1C during plant development.2008 · DOI: 10.1104/pp.108.116863
`At2g44590`	Putative microtubule-associated force-producing protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022574 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process

GO:0010036 response to boron-containing substance Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010091 trichome branching Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030100 regulation of endocytosis Biological Process

GO:0048480 stigma development Biological Process

GO:0048766 root hair initiation Biological Process

GO:0050832 defense response to fungus Biological Process

KEGG gene cross-reference

ath:AT3G60190

ath:AT3G61760

ath:AT5G42080

gmx:100037461

gmx:547855

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.407

Rank 1 · TkA07G019040 · TK1151

Nucleus0.303

Rank 2 · TkA07G019040 · TK1151

Mitochondrion0.173

Rank 3 · TkA07G019040 · TK1151

Cell membrane0.098

Rank 4 · TkA07G019040 · TK1151

Peroxisome0.075

Rank 5 · TkA07G019040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00350Dynamin_N41-69 aa

PF00350Dynamin_N71-149 aa

PF01031Dynamin_M142-275 aa

PF18734HEPN_AbiU2247-387 aa

PF02212GED324-391 aa

PF23435DUF7121332-401 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G019040	`PF00350`	Dynamin_N	41	69	1.1e-19	71.8
TkA07G019040	`PF00350`	Dynamin_N	71	149	1.1e-19	71.8
TkA07G019040	`PF01031`	Dynamin_M	142	275	3.1e-34	119.2
TkA07G019040	`PF18734`	HEPN_AbiU2	247	387	0.093	12.9
TkA07G019040	`PF02212`	GED	324	391	1.2e-06	29.3
TkA07G019040	`PF23435`	DUF7121	332	401	0.016	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNX5`	Arabidopsis thaliana	sp\|Q9FNX5\|DRP1E_ARATH Phragmoplastin DRP1E	45.600%	Swiss-Prot	Medium
`Q8LF21`	Arabidopsis thaliana	sp\|Q8LF21\|DRP1C_ARATH Phragmoplastin DRP1C	44.900%	Swiss-Prot	Medium
`Q8S3C9`	Arabidopsis thaliana	sp\|Q8S3C9\|DRP1D_ARATH Phragmoplastin DRP1D	60.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card