TkA07G018990 | RubberDandelionOmics

Gene overview

TkA07G018990

Reference: TK1151 Chr: Chr07 Coordinates: 5119445-5128272 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2070 bp · TkA07G018990|TK1151|cDNA

AAACAATATAAGGGTAGAATCAAACTCATCTTTAATAATCTTCACAATATTTTGTACCTTAAGACAAATTTTCTACCTGGATAAATTTCAAGAGTAGGGTCCATGCTCTCAAGTGCCCTGTGTAAGAAATAAAGGTAGCCAATTCGTTCGGTAATATCACACCCTTTCCCCACCCTCCAACCTGCTAAATTCAATAAATACCAAATTTCCACTCATTTCCAGACGACTAAACCGCCATCGCCGTCTCGCATCGCCACCGC...

CDS

Download CDS FASTA

1452 bp · TkA07G018990|TK1151|CDS

ATGGATCAAGAAATTCAAGCAAAGTTGCTTCGACGTGATGAAGAAGAAGAAGAACGTGATTTGAAAGGAAGAGTATGGGACGAATCAAAAAAGATTTGGCGGGTTGCATTGCCAGGTGTCATATCAAGAGTTTGTGCATTTGGAACAATTGTTGTCACACAATCATTCATCGGCCACGTCAGCAACTTAGATCTTGCCGGTTATGCCCTTGTCCAAACACTTACCGTCCGATTTGTCAATGGAATCCTCTTAGGAATGTC...

Protein

Download Protein FASTA

483 aa · TkA07G018990|TK1151|PROTEIN

MDQEIQAKLLRRDEEEEERDLKGRVWDESKKIWRVALPGVISRVCAFGTIVVTQSFIGHVSNLDLAGYALVQTLTVRFVNGILLGMSSATETLCGQAFGAGQHHMLGIYLQRSWIVDLTTLTALLPIFIFASQIFKLLGVDKSVSESGGYVSLWFIPFVYNFIFSLTIQMYLQAQLKNMVIAWLSIFQFGIHIPLSLLFVYKFNLGVGGAMVALCMSSWFLVVGEFVYIFGGWCPYSWKGFTVAAFKDLFPVVKLSISSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G018990`
TK1151 ID	TkA07G018990
OH-1004 ID	LXL04_026935
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G018990

Location Chr07:5119445-5128272 (-)

Description Similar to DTX24: Protein DETOXIFICATION 24

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03620`	Protein DETOXIFICATION 24.	No verified direct reference in this release
`At5g17700`	Protein DETOXIFICATION 25.	No verified direct reference in this release
`At1g33110`	Protein DETOXIFICATION 21.	No verified direct reference in this release
`At1g33100`	Protein DETOXIFICATION 20.	No verified direct reference in this release
`At1g33090`	Protein DETOXIFICATION 22.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026935 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:1990961 xenobiotic detoxification by transmembrane export across the plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0042910 xenobiotic transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G33090

ath:AT1G33100

ath:AT1G33110

ath:AT3G03620

ath:AT5G17700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.386

Rank 1 · TkA07G018990 · TK1151

Lysosome / Vacuole0.333

Rank 2 · TkA07G018990 · TK1151

Endoplasmic reticulum0.136

Rank 3 · TkA07G018990 · TK1151

Cytoplasm0.076

Rank 4 · TkA07G018990 · TK1151

Golgi apparatus0.074

Rank 5 · TkA07G018990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01554MatE47-197 aa

PF28190MMSYN1_0478164-182 aa

PF01554MatE260-420 aa

PF26873Phage_T4_Y06O329-357 aa

PF28190MMSYN1_0478332-419 aa

PF26873Phage_T4_Y06O411-478 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G018990	`PF01554`	MatE	47	197	2.7e-46	157.9
TkA07G018990	`PF28190`	MMSYN1_0478	164	182	0.023	15.2
TkA07G018990	`PF01554`	MatE	260	420	2.7e-46	157.9
TkA07G018990	`PF26873`	Phage_T4_Y06O	329	357	0.052	14.3
TkA07G018990	`PF28190`	MMSYN1_0478	332	419	0.023	15.2
TkA07G018990	`PF26873`	Phage_T4_Y06O	411	478	0.052	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J158`	Arabidopsis thaliana	sp\|F4J158\|DTX24_ARATH Protein DETOXIFICATION 24	52.400%	Swiss-Prot	High
`Q8L616`	Arabidopsis thaliana	sp\|Q8L616\|DTX25_ARATH Protein DETOXIFICATION 25	49.100%	Swiss-Prot	Medium
`Q8W488`	Arabidopsis thaliana	sp\|Q8W488\|DTX21_ARATH Protein DETOXIFICATION 21	49.400%	Swiss-Prot	Medium
`F4HPH2`	Arabidopsis thaliana	sp\|F4HPH2\|DTX20_ARATH Protein DETOXIFICATION 20	50.100%	Swiss-Prot	High
`F4HPH1`	Arabidopsis thaliana	sp\|F4HPH1\|DTX22_ARATH Protein DETOXIFICATION 22	49.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card