TkA07G015260 | RubberDandelionOmics

Gene overview

TkA07G015260

Reference: TK1151 Chr: Chr07 Coordinates: 4146259-4151518 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1813 bp · TkA07G015260|TK1151|cDNA

GCGAACTCACTTAGGATAAGGTATAATAAATGGTAGCCCGAAGTTACTCCTTGGCCATATGTACACATGCAAACTACACCACAAAATGCAACTTCCTTTCTTGATTCTCATATGCACCATACATGCTACATGTCCTCTAGGACCTATTCTCATTAATATACGAGCTTTCAACCCTTAACCAACTCATGTGCAAGCTTCCCTTTCTTCTGTATCTATTTCATATATCTATTTTGTAAATTATCTTCTCAAGAACTCATGAA...

CDS

Download CDS FASTA

1299 bp · TkA07G015260|TK1151|CDS

ATGAATCAGTGTGTACCAAGTTGGGATCTTGAAGACATCAACCCTAATCAGAATGTTTTCAAATTGGATTTTGAAGTGGCCGAATTAACATGGGAAAACGGGCAGTTGGCCATGCACGAGTTGGGTCACCGGCGCGTGCCTTCCAAATACACATGGAGCAAGCCACGCGCCGCCGAGACTCTAGAGGCGATAGTCGACCAAGCCAAGCTCCAAACCTACAACAAAGTAGCGGTTAACGGCGAAGAAGTTGTACCATGGCT...

Protein

Download Protein FASTA

432 aa · TkA07G015260|TK1151|PROTEIN

MNQCVPSWDLEDINPNQNVFKLDFEVAELTWENGQLAMHELGHRRVPSKYTWSKPRAAETLEAIVDQAKLQTYNKVAVNGEEVVPWLQHRRNPTAATGSVNASGTMTSDALVPSSNNRASALDGGCSTRVGSCSADQSAFLGRRRDGQGGGSTTVAGHEWSSCRDRSVSTWSETVATIDTYDGDGDGDLGGSRLMSTSTGSPQNTSSGEDCSKSTSPDDSACHCRPQPDANVAREKRKGKAKPSISNKRRRTAAIHNQSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G015260`
TK1151 ID	TkA07G015260
OH-1004 ID	LXL04_026884
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G015260

Location Chr07:4146259-4151518 (-)

Description Similar to UNE10: Transcription factor UNE10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00050`	Transcription factor binding to G-box elements (5'-CACGTG-3') in target genes promoters, particularly in far-red light but barely in the dark.	PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
`At5g61270`	Transcription factor acting negatively in the phytochrome B signaling pathway under prolonged red light.	The Arabidopsis phytochrome-interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels.2008 · DOI: 10.1105/tpc.107.052142
`At5g67110`	Required for the dehiscence of fruit, especially for the separation of the valve cells from the replum.	No verified direct reference in this release
`At4g36930`	Transcription factor that plays a role in floral organogenesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0782500`	Transcription factor that may act as negative regulator of phyB-dependent light signal transduction.	Characterization of a set of phytochrome-interacting factor-like bHLH proteins in Oryza sativa.2007 · DOI: 10.1271/bbb.60643 Rice phytochrome-interacting factor-like protein OsPIL1 functions as a key regulator of internode elongation and induces a morphological response to drought stress.2012 · DOI: 10.1073/pnas.1207324109

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026884 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0007165 signal transduction Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009637 response to blue light Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G09530

ath:AT2G20180

ath:AT4G00050

ath:AT5G67110

dosa:Os01g0286100

osa:4327916

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.979

Rank 1 · TkA07G015260 · TK1151

Cytoplasm0.086

Rank 2 · TkA07G015260 · TK1151

Cell membrane0.022

Rank 3 · TkA07G015260 · TK1151

Endoplasmic reticulum0.012

Rank 4 · TkA07G015260 · TK1151

Plastid0.009

Rank 5 · TkA07G015260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15279SOBP196-412 aa

PF00010HLH256-301 aa

PF23177bHLH_IRO3258-312 aa

PF23173bHLH_SAC51259-303 aa

PF23176bHLH_LHW263-311 aa

PF08541ACP_syn_III_C302-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G015260	`PF15279`	SOBP	196	412	1.4	10.1
TkA07G015260	`PF00010`	HLH	256	301	1.3e-14	54.4
TkA07G015260	`PF23177`	bHLH_IRO3	258	312	1.6e-06	29.1
TkA07G015260	`PF23173`	bHLH_SAC51	259	303	2.6e-07	31.2
TkA07G015260	`PF23176`	bHLH_LHW	263	311	0.0013	19.4
TkA07G015260	`PF08541`	ACP_syn_III_C	302	350	0.024	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZ38`	Arabidopsis thaliana	sp\|Q8GZ38\|UNE10_ARATH Transcription factor UNE10	46.800%	Swiss-Prot	Medium
`Q570R7`	Arabidopsis thaliana	sp\|Q570R7\|PIF7_ARATH Transcription factor PIF7	70.700%	Swiss-Prot	Low
`Q9FHA2`	Arabidopsis thaliana	sp\|Q9FHA2\|ALC_ARATH Transcription factor ALC	58.400%	Swiss-Prot	Low
`Q9FUA4`	Arabidopsis thaliana	sp\|Q9FUA4\|SPT_ARATH Transcription factor SPATULA	42.500%	Swiss-Prot	Low
`Q10CH5`	Oryza sativa subsp. japonica	sp\|Q10CH5\|PIL13_ORYSJ Transcription factor PHYTOCHROME INTERACTING FACTOR-LIKE 13	39.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card