TkA07G010490 | RubberDandelionOmics

Gene overview

TkA07G010490

Reference: TK1151 Chr: Chr07 Coordinates: 2913166-2917177 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · TkA07G010490|TK1151|cDNA

ATTATTCACGCGTTTAAAAGTATTCTAGCTGAAAATTTTACGAGAAGGATTTGATAATCGTGTCACATAACTCCCAAATTTTGCTTTTAGAAATCACTAGGGTTTGCGAGAAGGATCTGATATATATTACGTATAATTACCGGTGTCCAAAATGTGTTGAGCTGAAGCTTCCTCGTGAAGGTGCTGCTTTCTGCACTCAGGACTGTTTCAAGGCATCATGGAGCTCTCATAAATCAGTTCATTTGAAAGCAAAGTTATCA...

CDS

Download CDS FASTA

1206 bp · TkA07G010490|TK1151|CDS

ATGGCAGGGGAAGATGTTACGGACAGTGGTTTATCATGTGTTAAATGTGGCAAGCCTGCTCATCTTCAGTGTCCAAAATGTGTTGAGCTGAAGCTTCCTCGTGAAGGTGCTGCTTTCTGCACTCAGGACTGTTTCAAGGCATCATGGAGCTCTCATAAATCAGTTCATTTGAAAGCAAAGTTATCATCAGTTGGATCAAGCAATCCATGGGAGCTTAATATAGCTTCACCAAGTGATGGTTGGCTTTATTGTTTGAGGAA...

Protein

Download Protein FASTA

401 aa · TkA07G010490|TK1151|PROTEIN

MAGEDVTDSGLSCVKCGKPAHLQCPKCVELKLPREGAAFCTQDCFKASWSSHKSVHLKAKLSSVGSSNPWELNIASPSDGWLYCLRKGQSRTAQIPHFDWTGPLRPYPISKKRVIPAGIELPDWALDGTPKIEPISDLQHVVEIKTPEQIERMRETSRIAREVLDAAARVVRPGVTTDEIDAVVHEATIAAGAYPSPLNYHFFPKSCCTSVNEVICHGIPDGRKLEDGDIVNIDVTVYYKGVHGDLNETYFVGNVDEASL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G010490`
TK1151 ID	TkA07G010490
OH-1004 ID	LXL04_026850
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 85.319 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G010490

Location Chr07:2913166-2917177 (-)

Description Similar to MAP1A: Methionine aminopeptidase 1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45240`	Cotranslationally removes the N-terminal methionine from nascent proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026850 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006882 intracellular zinc ion homeostasis Biological Process

GO:0016485 protein processing Biological Process

GO:0031365 N-terminal protein amino acid modification Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004239 initiator methionyl aminopeptidase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0070006 metalloaminopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT2G45240

ddi:DDB_G0279433

xla:399247

xtr:496944

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.633

Rank 1 · TkA07G010490 · TK1151

Nucleus0.290

Rank 2 · TkA07G010490 · TK1151

Mitochondrion0.120

Rank 3 · TkA07G010490 · TK1151

Cell membrane0.070

Rank 4 · TkA07G010490 · TK1151

Peroxisome0.069

Rank 5 · TkA07G010490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01753zf-MYND13-55 aa

PF24324MYND_ZMYND11_ZMYD813-55 aa

PF22082TtuA_LIM_N13-20 aa

PF15801zf-C6H214-57 aa

PF22082TtuA_LIM_N31-40 aa

PF01753zf-MYND83-90 aa

PF00557Peptidase_M24151-379 aa

PF01753zf-MYND265-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G010490	`PF01753`	zf-MYND	13	55	0.0026	18.5
TkA07G010490	`PF24324`	MYND_ZMYND11_ZMYD8	13	55	1.2	10.0
TkA07G010490	`PF22082`	TtuA_LIM_N	13	20	4.9	8.1
TkA07G010490	`PF15801`	zf-C6H2	14	57	1.3e-14	54.7
TkA07G010490	`PF22082`	TtuA_LIM_N	31	40	4.9	8.1
TkA07G010490	`PF01753`	zf-MYND	83	90	0.0026	18.5
TkA07G010490	`PF00557`	Peptidase_M24	151	379	4e-54	184.2
TkA07G010490	`PF01753`	zf-MYND	265	270	0.0026	18.5
TkA07G010490	`PF24324`	MYND_ZMYND11_ZMYD8	265	271	1.2	10.0
TkA07G010490	`PF01753`	zf-MYND	305	316	0.0026	18.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLN5`	Arabidopsis thaliana	sp\|Q9SLN5\|MAP1A_ARATH Methionine aminopeptidase 1A	82.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card