TkA07G005110 | RubberDandelionOmics

Gene overview

TkA07G005110

Reference: TK1151 Chr: Chr07 Coordinates: 1429187-1430614 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1239 bp · TkA07G005110|TK1151|cDNA

ATGGTGCCAATCATGGCGAGAGGTCATCTTACACCCTTCTTACAATTAGCCCAAAAAATCCTCCACCACAACCCCATCTTCACCATCACCATCGTCAACACTCCTCTCAACATCAACTACCTCCGCTCCGCCATAGCCAGCCACCCATCTCCGCCGCCACAAATCCATCTTAAATCACTCCCCTTCAATAGCTCCGACCATGGCCTCCCTCCTAACTCAGAAAACGCCAATGACTTATCTGTCGCCCAACTCATCACACT...

CDS

Download CDS FASTA

1239 bp · TkA07G005110|TK1151|CDS

ATGGTGCCAATCATGGCGAGAGGTCATCTTACACCCTTCTTACAATTAGCCCAAAAAATCCTCCACCACAACCCCATCTTCACCATCACCATCGTCAACACTCCTCTCAACATCAACTACCTCCGCTCCGCCATAGCCAGCCACCCATCTCCGCCGCCACAAATCCATCTTAAATCACTCCCCTTCAATAGCTCCGACCATGGCCTCCCTCCTAACTCAGAAAACGCCAATGACTTATCTGTCGCCCAACTCATCACACT...

Protein

Download Protein FASTA

412 aa · TkA07G005110|TK1151|PROTEIN

MVPIMARGHLTPFLQLAQKILHHNPIFTITIVNTPLNINYLRSAIASHPSPPPQIHLKSLPFNSSDHGLPPNSENANDLSVAQLITLFHASTTLETPLRGFIADMVAGDGSPPVCFISDMFMGWVNDVAKDFGTVNYTFVTSGAYGTTAFCSIYMNLPHRNTVHGGTLERFQVPGFPESFRFSITQLTQNLLDADGENERSRFFQPQISHCLRSHGWLCNTSEEIENTISETQMMELAKGLVESKKPFIWVIRPPIGFDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G005110`
TK1151 ID	TkA07G005110
OH-1004 ID	LXL04_036325
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	62.600
Protein coverage (%)	TK1151 99.515 / OH-1004 97.172 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G005110

Location Chr07:1429187-1430614 (-)

Description Similar to UGT92A1: UDP-glycosyltransferase 92A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12890`	UDP-glycosyltransferase 92A1.	No verified direct reference in this release
`At2g36790`	Acts as a UDP-glucose:flavonol-3-O-glycoside-7-O- glucosyltransferase. 6- and 7-hydroxyflavone, but not 3- or 5- hydroxyflavone are accepted as substrates.	UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m303523200
`At2g36800`	Specifically catalyzes 23-O-glucosylation of brassinosteroids, resulting probably in their inactivation.	Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m307552200 N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana.2004 · DOI: 10.1074/jbc.m409569200 The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids.2005 · DOI: 10.1073/pnas.0504279102
`At2g36760`	UDP-glycosyltransferase 73C2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036325 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009636 response to toxic substance Biological Process

GO:0010224 response to UV-B Biological Process

GO:0016117 carotenoid biosynthetic process Biological Process

GO:0016131 brassinosteroid metabolic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0098754 detoxification Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G36750

ath:AT2G36780

ath:AT2G36800

ath:AT5G12890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.754

Rank 1 · TkA07G005110 · TK1151

Nucleus0.222

Rank 2 · TkA07G005110 · TK1151

Peroxisome0.083

Rank 3 · TkA07G005110 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA07G005110 · TK1151

Plastid0.051

Rank 5 · TkA07G005110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N1-164 aa

PF00201UDPGT228-379 aa

PF04101Glyco_tran_28_C282-373 aa

PF06722EryCIII-like_C285-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G005110	`PF26168`	Glyco_transf_N	1	164	0.00047	20.8
TkA07G005110	`PF00201`	UDPGT	228	379	1.7e-24	87.2
TkA07G005110	`PF04101`	Glyco_tran_28_C	282	373	3e-05	24.8
TkA07G005110	`PF06722`	EryCIII-like_C	285	370	0.0025	18.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXV0`	Arabidopsis thaliana	sp\|Q9LXV0\|U92A1_ARATH UDP-glycosyltransferase 92A1	36.100%	Swiss-Prot	Medium
`Q9ZQ95`	Arabidopsis thaliana	sp\|Q9ZQ95\|U73C6_ARATH UDP-glycosyltransferase 73C6	28.700%	Swiss-Prot	Low
`Q9ZQ94`	Arabidopsis thaliana	sp\|Q9ZQ94\|U73C5_ARATH UDP-glycosyltransferase 73C5	29.300%	Swiss-Prot	Low
`Q9ZQ98`	Arabidopsis thaliana	sp\|Q9ZQ98\|U73C2_ARATH UDP-glycosyltransferase 73C2	28.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card