TkA06G469590 | RubberDandelionOmics

Gene overview

TkA06G469590

Reference: TK1151 Chr: Chr06 Coordinates: 116126372-116131379 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1672 bp · TkA06G469590|TK1151|cDNA

CGAGAAGTCATTTTTAATCATATCGCCGGTACCGGAGTTGCTTCCCCACTGTCTCCGATCTCTCCACTGATGGCAGATAAAGAGGAAGGGGAGGAAACTGTCCCACGTGGAGCTGACTGGGAAGTTGTATCACTAACAGCATCAACATATGCAGCTGCCCCTGGCCCACATGTGAAAGATGATCAAAAGAGTCAACTACTTGACTCAAATAAAACTGAAACGTCAAATGCATTATTCATGTCTGGTCATTTTGTCTTCCC...

CDS

Download CDS FASTA

705 bp · TkA06G469590|TK1151|CDS

ATGGCAGATAAAGAGGAAGGGGAGGAAACTGTCCCACGTGGAGCTGACTGGGAAGTTGTATCACTAACAGCATCAACATATGCAGCTGCCCCTGGCCCACATGTGAAAGATGATCAAAAGAGTCAACTACTTGACTCAAATAAAACTGAAACGTCAAATGCATTATTCATGTCTGGTCATTTTGTCTTCCCACCAAGTCAACATGAGAATCTACCACTCGAATCCCAAAACACAGAGATCGCTGATGATGATGATGATGA...

Protein

Download Protein FASTA

234 aa · TkA06G469590|TK1151|PROTEIN

MADKEEGEETVPRGADWEVVSLTASTYAAAPGPHVKDDQKSQLLDSNKTETSNALFMSGHFVFPPSQHENLPLESQNTEIADDDDDDNDNVSESIKEEGEKSSAKDEDNWNISKLTESYAKRSDFEDPAALIDFPGKEQSIYDSATFHTFHSEPIIDDEGRVLVESVESSDSSSSSDVMNVPKRMEDDDDDDDDGSGVVPYAAWWKKHAASLYSHAKEANTFWSILLLLLLWGL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G469590`
TK1151 ID	TkA06G469590
OH-1004 ID	LXL04_026719
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	37.700
Protein coverage (%)	TK1151 96.154 / OH-1004 74.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G469590

Location Chr06:116126372-116131379 (-)

Description Similar to ATI2: ATG8-interacting protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45980`	Involved in a special stress-induced plastid-to-vacuole protein trafficking pathway.	A new type of compartment, defined by plant-specific Atg8-interacting proteins, is induced upon exposure of Arabidopsis plants to carbon starvation.2012 · DOI: 10.1105/tpc.111.093112 Arabidopsis ATG8-INTERACTING PROTEIN1 is involved in autophagy-dependent vesicular trafficking of plastid proteins to the vacuole.2014 · DOI: 10.1105/tpc.114.129999
`At4g00355`	May be involved in salt stress-induced vesicle-to-vacuole trafficking pathway.	A new type of compartment, defined by plant-specific Atg8-interacting proteins, is induced upon exposure of Arabidopsis plants to carbon starvation.2012 · DOI: 10.1105/tpc.111.093112

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026719 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0071211 protein targeting to vacuole involved in autophagy Biological Process

GO:1904962 plastid to vacuole vesicle-mediated transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0160247 autophagy cargo adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT2G45980

ath:AT4G00355

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.340

Rank 1 · TkA06G469590 · TK1151

Cytoplasm0.282

Rank 2 · TkA06G469590 · TK1151

Endoplasmic reticulum0.274

Rank 3 · TkA06G469590 · TK1151

Cell membrane0.179

Rank 4 · TkA06G469590 · TK1151

Plastid0.107

Rank 5 · TkA06G469590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06524NOA3667-108 aa

PF06524NOA36168-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G469590	`PF06524`	NOA36	67	108	1.7	8.6
TkA06G469590	`PF06524`	NOA36	168	211	1.7	8.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82775`	Arabidopsis thaliana	sp\|O82775\|ATI1_ARATH ATG8-interacting protein 1	57.400%	Swiss-Prot	Low
`Q8VY98`	Arabidopsis thaliana	sp\|Q8VY98\|ATI2_ARATH ATG8-interacting protein 2	55.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card