TkA06G449990 | RubberDandelionOmics

Gene overview

TkA06G449990

Reference: TK1151 Chr: Chr06 Coordinates: 111181462-111187896 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · TkA06G449990|TK1151|cDNA

ATGAAAAATGTCGCGAATACTAGTGTGTTGAGATGGAGTGATCGGTTGTTTTGCTTGTGGGAAGGTGGGCCACCTCATGAGATTGAACAAGTGTCATTGGATACGATTGGAGAGTTTGATTTGATCAAAAATCGTAAAGAATCAGCCGACAGATATATGTCTAAAAGTGGCATTGTTTTAGATCTTGTTACAAGCATATTGAAGCCGATATTGTATGGTGTGTTCAAGATGCCACCACAACGACTGTTGGCGCATTATAA...

CDS

Download CDS FASTA

768 bp · TkA06G449990|TK1151|CDS

ATGAAAAATGTCGCGAATACTAGTGTGTTGAGATGGAGTGATCGGTTGTTTTGCTTGTGGGAAGGTGGGCCACCTCATGAGATTGAACAAGTGTCATTGGATACGATTGGAGAGTTTGATTTGATCAAAAATCGTAAAGAATCAGCCGACAGATATATGTCTAAAAGTGGCATTGTTTTAGATCTTGTTACAAGCATATTGAAGCCGATATTGTATGGTGTGTTCAAGATGCCACCACAACGACTGTTGGCGCATTATAA...

Protein

Download Protein FASTA

255 aa · TkA06G449990|TK1151|PROTEIN

MKNVANTSVLRWSDRLFCLWEGGPPHEIEQVSLDTIGEFDLIKNRKESADRYMSKSGIVLDLVTSILKPILYGVFKMPPQRLLAHYKVDASRNRLLIMSCNAEDLLLPRSTFTFYEFDSNFKIQQKQEFYIPEHLMIHDWAFTDSHYVLFANRCKLNIFGAMAAIGGYTPMVSALLVDDSKSTSPIYLLPRFPDHKQERDWKVPIEVPLQMWMLHIGNAFEEREHNGNKQIQIQASGCSYKWFNIFSENVRYVCF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G449990`
TK1151 ID	TkA06G449990
OH-1004 ID	LXL04_022768
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	71.100
Protein coverage (%)	TK1151 95.686 / OH-1004 39.870 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G449990

Location Chr06:111181462-111187896 (+)

Description Similar to CCD7: Carotenoid cleavage dioxygenase 7, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44990`	Involved in strigolactones biosynthesis by cleaving asymmetrically a variety of linear and cyclic carotenoids at the 9-10 double bond.	MAX3/CCD7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel plant signaling molecule.2004 · DOI: 10.1016/j.cub.2004.06.061 Characterization of three members of the Arabidopsis carotenoid cleavage dioxygenase family demonstrates the divergent roles of this multifunctional enzyme family.2006 · DOI: 10.1111/j.1365-313x.2006.02666.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0550600`	Involved in strigolactones biosynthesis by cleaving asymmetrically a variety of linear and cyclic carotenoids at the 9-10 double bond.	The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds.2006 · DOI: 10.1111/j.1365-313x.2006.02916.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022768 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009635 response to herbicide Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009733 response to auxin Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0010114 response to red light Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0016121 carotene catabolic process Biological Process

GO:0016124 xanthophyll catabolic process Biological Process

GO:1901601 strigolactone biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ag:ACP17973

ath:AT2G44990

ath:AT3G24220

dosa:Os04g0550600

syn:sll1541

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.462

Rank 1 · TkA06G449990 · TK1151

Mitochondrion0.380

Rank 2 · TkA06G449990 · TK1151

Cytoplasm0.080

Rank 3 · TkA06G449990 · TK1151

Cell membrane0.058

Rank 4 · TkA06G449990 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA06G449990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03055RPE652-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G449990	`PF03055`	RPE65	2	246	1.7e-32	113.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XJM2`	Arabidopsis thaliana	sp\|Q7XJM2\|CCD7_ARATH Carotenoid cleavage dioxygenase 7, chloroplastic	59.900%	Swiss-Prot	High
`Q7XU29`	Oryza sativa subsp. japonica	sp\|Q7XU29\|CCD7_ORYSJ Carotenoid cleavage dioxygenase 7, chloroplastic	54.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card